EMAIL THIS PAGE TO A FRIEND

GTF3C2

general transcription factor IIIC, polypeptide 2, beta 110kDa

121 Gene Product Result for
Synonyms: TFIIIC-BETA TFIIIC110
UniProtKB ID: Q8WUA4, D6W557, Q16632, Q9BWI7
Gene ID:
Mouse(71752) general transcription factor IIIC, polypeptide 2, beta
Rat(313914) general transcription factor IIIC, polypeptide 2, beta
domestic guinea pig(100727508) general transcription factor IIIC, polypeptide 2, beta 110kDa
naked mole-rat(101713285) general transcription factor IIIC, polypeptide 2, beta 110kDa
sheep(101116974) general transcription factor IIIC, polypeptide 2, beta 110kDa
Domestic Rabbit(100349733) general transcription factor IIIC, polypeptide 2, beta 110kDa
Zebrafish(563394) general transcription factor IIIC, polypeptide 2, beta
cow(782752) general transcription factor IIIC, polypeptide 2, beta 110kDa
Horse(100071210) general transcription factor IIIC, polypeptide 2, beta 110kDa
chicken(430980) general transcription factor IIIC, polypeptide 2, beta 110kDa
domestic cat(101099200) general transcription factor IIIC, polypeptide 2, beta 110kDa
dog(483010) general transcription factor IIIC, polypeptide 2, beta 110kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027901 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027901 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027901 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001521 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001035521 Rosetta Predictions human pricing
NM_001521 Rosetta Predictions human pricing
NM_001025120 Rosetta Predictions rat pricing
NM_027901 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043830 predicted 2135
2 SASI_Hs02_00308203 predicted 1655
3 SASI_Hs02_00308204 predicted 2526
4 SASI_Hs01_00043831 predicted 1382
5 SASI_Hs01_00043832 predicted 2821
6 SASI_Hs01_00043834 predicted 2212
7 SASI_Hs01_00043835 predicted 1394
8 SASI_Hs01_00043836 predicted 524
9 SASI_Hs01_00043837 predicted 2353
10 SASI_Hs01_00043838 predicted 1406
11 SASI_Hs01_00043829 predicted 1892
12 SASI_Hs01_00043833 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087899 predicted 2216
2 SASI_Hs02_00332047 predicted 1728
3 SASI_Hs02_00332048 predicted 2605
4 SASI_Hs01_00087900 predicted 1454
5 SASI_Hs01_00087901 predicted 2898
6 SASI_Hs01_00087903 predicted 2296
7 SASI_Hs01_00087904 predicted 1472
8 SASI_Hs01_00087905 predicted 605
9 SASI_Hs01_00087906 predicted 2432
10 SASI_Hs01_00087907 predicted 1478
11 SASI_Hs01_00087898 predicted 1966
12 SASI_Hs01_00087902 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032114 predicted 3187
2 SASI_Rn01_00032115 predicted 3120
3 SASI_Rn01_00032116 predicted 2285
4 SASI_Rn02_00203018 predicted 2685
5 SASI_Rn01_00032118 predicted 2503
6 SASI_Rn01_00032119 predicted 2022
7 SASI_Rn02_00203019 predicted 2477
8 SASI_Rn01_00032120 predicted 2976
9 SASI_Rn01_00032121 predicted 2032
10 SASI_Rn01_00032122 predicted 1541
11 SASI_Rn01_00032117 predicted 1565
12 SASI_Rn01_00032123 predicted 1580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027187 predicted 2772
2 SASI_Mm02_00332874 predicted 2116
3 SASI_Mm01_00027188 predicted 2358
4 SASI_Mm01_00027189 predicted 2201
5 SASI_Mm02_00332875 predicted 3040
6 SASI_Mm01_00027190 predicted 2516
7 SASI_Mm01_00027191 predicted 2506
8 SASI_Mm01_00027192 predicted 1379
9 SASI_Mm01_00027193 predicted 2810
10 SASI_Mm01_00027195 predicted 1864
11 SASI_Mm01_00027194 predicted 2955
12 SASI_Mm01_00027196 predicted 1396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027901
VALIDATED
GTF3C2 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 2, beta 110kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027901.2-1157s21c1
Sequence:CCGGTCCCAATGGCTTACCCAATTACTCGAGTAATTGGGTAAGCCATTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027901.2-3501s21c1
Sequence:CCGGGCTGCTCATAACTTAACTTTACTCGAGTAAAGTTAAGTTATGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027901.2-999s21c1
Sequence:CCGGGCTCGGGATGAAGACTTTGTTCTCGAGAACAAAGTCTTCATCCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-777s1c1
Sequence:CCGGGCTCGGGATGAAGACTTTGTTCTCGAGAACAAAGTCTTCATCCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-1898s1c1
Sequence:CCGGCCGTACAATTCAGTGGTGCAACTCGAGTTGCACCACTGAATTGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-2808s1c1
Sequence:CCGGGCTGCTCATAACTTAACTTTACTCGAGTAAAGTTAAGTTATGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-509s1c1
Sequence:CCGGGCTACTATTGAAGTTGTCCAACTCGAGTTGGACAACTTCAATAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-2603s1c1
Sequence:CCGGGCATATTGTGAAGGAGGTAAACTCGAGTTTACCTCCTTCACAATATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027901.2-2120s21c1
Sequence:CCGGCCGTACAATTCAGTGGTGCAACTCGAGTTGCACCACTGAATTGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027901.2-1376s21c1
Sequence:CCGGTGGCACAATCTACCGAATAAACTCGAGTTTATTCGGTAGATTGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027901
VALIDATED
GTF3C2 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 2, beta 110kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027901.2-1157s21c1
Sequence:CCGGTCCCAATGGCTTACCCAATTACTCGAGTAATTGGGTAAGCCATTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027901.2-3501s21c1
Sequence:CCGGGCTGCTCATAACTTAACTTTACTCGAGTAAAGTTAAGTTATGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027901.2-999s21c1
Sequence:CCGGGCTCGGGATGAAGACTTTGTTCTCGAGAACAAAGTCTTCATCCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-777s1c1
Sequence:CCGGGCTCGGGATGAAGACTTTGTTCTCGAGAACAAAGTCTTCATCCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-1898s1c1
Sequence:CCGGCCGTACAATTCAGTGGTGCAACTCGAGTTGCACCACTGAATTGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-2808s1c1
Sequence:CCGGGCTGCTCATAACTTAACTTTACTCGAGTAAAGTTAAGTTATGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-509s1c1
Sequence:CCGGGCTACTATTGAAGTTGTCCAACTCGAGTTGGACAACTTCAATAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-2603s1c1
Sequence:CCGGGCATATTGTGAAGGAGGTAAACTCGAGTTTACCTCCTTCACAATATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027901.2-2120s21c1
Sequence:CCGGCCGTACAATTCAGTGGTGCAACTCGAGTTGCACCACTGAATTGTACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027901.2-1376s21c1
Sequence:CCGGTGGCACAATCTACCGAATAAACTCGAGTTTATTCGGTAGATTGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027901
VALIDATED
GTF3C2 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 2, beta 110kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027901.2-1157s21c1
Sequence:CCGGTCCCAATGGCTTACCCAATTACTCGAGTAATTGGGTAAGCCATTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027901.2-3501s21c1
Sequence:CCGGGCTGCTCATAACTTAACTTTACTCGAGTAAAGTTAAGTTATGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027901.2-999s21c1
Sequence:CCGGGCTCGGGATGAAGACTTTGTTCTCGAGAACAAAGTCTTCATCCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-777s1c1
Sequence:CCGGGCTCGGGATGAAGACTTTGTTCTCGAGAACAAAGTCTTCATCCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-1898s1c1
Sequence:CCGGCCGTACAATTCAGTGGTGCAACTCGAGTTGCACCACTGAATTGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103990    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-2808s1c1
Sequence:CCGGGCTGCTCATAACTTAACTTTACTCGAGTAAAGTTAAGTTATGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-509s1c1
Sequence:CCGGGCTACTATTGAAGTTGTCCAACTCGAGTTGGACAACTTCAATAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027901.1-2603s1c1
Sequence:CCGGGCATATTGTGAAGGAGGTAAACTCGAGTTTACCTCCTTCACAATATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027901.2-2120s21c1
Sequence:CCGGCCGTACAATTCAGTGGTGCAACTCGAGTTGCACCACTGAATTGTACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027901.2-1376s21c1
Sequence:CCGGTGGCACAATCTACCGAATAAACTCGAGTTTATTCGGTAGATTGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001521
VALIDATED
GTF3C2 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 2, beta 110kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-3376s21c1
Sequence:CCGGGGAGTCAAACTGCTCATATTGCTCGAGCAATATGAGCAGTTTGACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-1467s21c1
Sequence:CCGGTGGCACCCTCTACCGAATAAACTCGAGTTTATTCGGTAGAGGGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-2071s21c1
Sequence:CCGGCACCTAGCTGCTGGATATTATCTCGAGATAATATCCAGCAGCTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001521.2-2545s21c1
Sequence:CCGGGAGCTCATTGCTGCTATATTACTCGAGTAATATAGCAGCAATGAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-3209s1c1
Sequence:CCGGGCCTTCTGAAACTTCCTCTTTCTCGAGAAAGAGGAAGTTTCAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-456s1c1
Sequence:CCGGGCCTAAGAAACGAGGTCGAAACTCGAGTTTCGACCTCGTTTCTTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-2275s1c1
Sequence:CCGGCGACCTGTAGAGCGAAGATTTCTCGAGAAATCTTCGCTCTACAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-1408s1c1
Sequence:CCGGGCCCACTTTGTCTATGGGATTCTCGAGAATCCCATAGACAAAGTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-1271s1c1
Sequence:CCGGCCTCGCAATATGTGGCTCTTTCTCGAGAAAGAGCCACATATTGCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-2599s21c1
Sequence:CCGGCGACCTGTAGAGCGAAGATTTCTCGAGAAATCTTCGCTCTACAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001521
VALIDATED
GTF3C2 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 2, beta 110kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-3376s21c1
Sequence:CCGGGGAGTCAAACTGCTCATATTGCTCGAGCAATATGAGCAGTTTGACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-1467s21c1
Sequence:CCGGTGGCACCCTCTACCGAATAAACTCGAGTTTATTCGGTAGAGGGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-2071s21c1
Sequence:CCGGCACCTAGCTGCTGGATATTATCTCGAGATAATATCCAGCAGCTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001521.2-2545s21c1
Sequence:CCGGGAGCTCATTGCTGCTATATTACTCGAGTAATATAGCAGCAATGAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-3209s1c1
Sequence:CCGGGCCTTCTGAAACTTCCTCTTTCTCGAGAAAGAGGAAGTTTCAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-456s1c1
Sequence:CCGGGCCTAAGAAACGAGGTCGAAACTCGAGTTTCGACCTCGTTTCTTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-2275s1c1
Sequence:CCGGCGACCTGTAGAGCGAAGATTTCTCGAGAAATCTTCGCTCTACAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-1408s1c1
Sequence:CCGGGCCCACTTTGTCTATGGGATTCTCGAGAATCCCATAGACAAAGTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-1271s1c1
Sequence:CCGGCCTCGCAATATGTGGCTCTTTCTCGAGAAAGAGCCACATATTGCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-2599s21c1
Sequence:CCGGCGACCTGTAGAGCGAAGATTTCTCGAGAAATCTTCGCTCTACAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001521
VALIDATED
GTF3C2 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 2, beta 110kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-3376s21c1
Sequence:CCGGGGAGTCAAACTGCTCATATTGCTCGAGCAATATGAGCAGTTTGACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-1467s21c1
Sequence:CCGGTGGCACCCTCTACCGAATAAACTCGAGTTTATTCGGTAGAGGGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-2071s21c1
Sequence:CCGGCACCTAGCTGCTGGATATTATCTCGAGATAATATCCAGCAGCTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001521.2-2545s21c1
Sequence:CCGGGAGCTCATTGCTGCTATATTACTCGAGTAATATAGCAGCAATGAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016178    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-3209s1c1
Sequence:CCGGGCCTTCTGAAACTTCCTCTTTCTCGAGAAAGAGGAAGTTTCAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-456s1c1
Sequence:CCGGGCCTAAGAAACGAGGTCGAAACTCGAGTTTCGACCTCGTTTCTTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-2275s1c1
Sequence:CCGGCGACCTGTAGAGCGAAGATTTCTCGAGAAATCTTCGCTCTACAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-1408s1c1
Sequence:CCGGGCCCACTTTGTCTATGGGATTCTCGAGAATCCCATAGACAAAGTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001521.1-1271s1c1
Sequence:CCGGCCTCGCAATATGTGGCTCTTTCTCGAGAAAGAGCCACATATTGCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001521.2-2599s21c1
Sequence:CCGGCGACCTGTAGAGCGAAGATTTCTCGAGAAATCTTCGCTCTACAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)