EMAIL THIS PAGE TO A FRIEND

GTF3C3

general transcription factor IIIC, polypeptide 3, 102kDa

59 Gene Product Result for
Synonyms: TFIIIC102 TFIIICgamma TFiiiC2-102
Gene ID:
Human(9330) Summary: The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(98488) general transcription factor IIIC, polypeptide 3
Rat(316810) general transcription factor IIIC, polypeptide 3
Zebrafish(553318) general transcription factor IIIC, polypeptide 3
chicken(424052) general transcription factor IIIC, polypeptide 3, 102kDa
cow(522473) general transcription factor IIIC, polypeptide 3, 102kDa
Horse(100055057) general transcription factor IIIC, polypeptide 3, 102kDa
domestic cat(101087767) general transcription factor IIIC, polypeptide 3, 102kDa
dog(478851) general transcription factor IIIC, polypeptide 3, 102kDa
sheep(101120220) general transcription factor IIIC, polypeptide 3, 102kDa
Domestic Rabbit(100348225) general transcription factor IIIC, polypeptide 3, 102kDa
domestic guinea pig(100715762) general transcription factor IIIC, polypeptide 3, 102kDa
naked mole-rat(101710433) general transcription factor IIIC, polypeptide 3, 102kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033194 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033194 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033194 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012086 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012086 Rosetta Predictions human pricing
NM_001108239 Rosetta Predictions rat pricing
NM_001033194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343568 predicted 1436
2 SASI_Hs01_00162547 predicted 1746
3 SASI_Hs01_00162549 predicted 2633
4 SASI_Hs02_00343569 predicted 1477
5 SASI_Hs01_00162550 predicted 2344
6 SASI_Hs01_00162551 predicted 933
7 SASI_Hs02_00343570 predicted 1552
8 SASI_Hs01_00162553 predicted 1632
9 SASI_Hs01_00162554 predicted 649
10 SASI_Hs01_00162556 predicted 705
11 SASI_Hs01_00162548 predicted 640
12 SASI_Hs01_00162552 predicted 2324
13 SASI_Hs01_00162555 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236694 predicted 795
2 SASI_Rn02_00236695 predicted 1746
3 SASI_Rn02_00236696 predicted 770
4 SASI_Rn02_00236697 predicted 1874
5 SASI_Rn02_00236698 predicted 2091
6 SASI_Rn02_00236699 predicted 1428
7 SASI_Rn02_00236700 predicted 2667
8 SASI_Rn02_00236701 predicted 2555
9 SASI_Rn02_00236702 predicted 2088
10 SASI_Rn02_00236703 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046579 predicted 2726
2 SASI_Mm02_00288296 predicted 827
3 SASI_Mm01_00046580 predicted 2264
4 SASI_Mm02_00288297 predicted 783
5 SASI_Mm02_00288298 predicted 1922
6 SASI_Mm02_00288299 predicted 2097
7 SASI_Mm02_00288300 predicted 583
8 SASI_Mm02_00288301 predicted 1305
9 SASI_Mm01_00046583 predicted 1870
10 SASI_Mm02_00288302 predicted 594
11 SASI_Mm01_00046577 predicted 2576
12 SASI_Mm01_00046578 predicted 2614
13 SASI_Mm01_00046581 predicted 2200
14 SASI_Mm01_00046582 predicted 2361
15 SASI_Mm01_00046584 predicted 1399
16 SASI_Mm01_00046585 predicted 2615
17 SASI_Mm01_00046586 predicted 2390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033194
VALIDATED
GTF3C3 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 3, 102kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-958s21c1
Sequence:CCGGGACAGCGCTTCAGCTATAAACCTCGAGGTTTATAGCTGAAGCGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-2788s21c1
Sequence:CCGGCATCACTGCTTGCTACCATTACTCGAGTAATGGTAGCAAGCAGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033194.1-614s1c1
Sequence:CCGGGCCATGATATACGAGGATCAACTCGAGTTGATCCTCGTATATCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-603s21c1
Sequence:CCGGCTCTACACTTGCCATGATATACTCGAGTATATCATGGCAAGTGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-500s21c1
Sequence:CCGGTCATGGGTGAAGCCAATATTCCTCGAGGAATATTGGCTTCACCCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033194.1-548s1c1
Sequence:CCGGGCCATATTGATGTGCATGGAACTCGAGTTCCATGCACATCAATATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033194.1-1927s1c1
Sequence:CCGGCCTTCTCTTAAAGGCCATATACTCGAGTATATGGCCTTTAAGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033194.2-2788s1c1
Sequence:CCGGCATCACTGCTTGCTACCATTACTCGAGTAATGGTAGCAAGCAGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-1073s21c1
Sequence:CCGGACAAAGCTTTGGAGGTAATTACTCGAGTAATTACCTCCAAAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033194
VALIDATED
GTF3C3 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 3, 102kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-958s21c1
Sequence:CCGGGACAGCGCTTCAGCTATAAACCTCGAGGTTTATAGCTGAAGCGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-2788s21c1
Sequence:CCGGCATCACTGCTTGCTACCATTACTCGAGTAATGGTAGCAAGCAGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033194.1-614s1c1
Sequence:CCGGGCCATGATATACGAGGATCAACTCGAGTTGATCCTCGTATATCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-603s21c1
Sequence:CCGGCTCTACACTTGCCATGATATACTCGAGTATATCATGGCAAGTGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-500s21c1
Sequence:CCGGTCATGGGTGAAGCCAATATTCCTCGAGGAATATTGGCTTCACCCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033194.1-548s1c1
Sequence:CCGGGCCATATTGATGTGCATGGAACTCGAGTTCCATGCACATCAATATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033194.1-1927s1c1
Sequence:CCGGCCTTCTCTTAAAGGCCATATACTCGAGTATATGGCCTTTAAGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033194.2-2788s1c1
Sequence:CCGGCATCACTGCTTGCTACCATTACTCGAGTAATGGTAGCAAGCAGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-1073s21c1
Sequence:CCGGACAAAGCTTTGGAGGTAATTACTCGAGTAATTACCTCCAAAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033194
VALIDATED
GTF3C3 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 3, 102kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-958s21c1
Sequence:CCGGGACAGCGCTTCAGCTATAAACCTCGAGGTTTATAGCTGAAGCGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241914    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-2788s21c1
Sequence:CCGGCATCACTGCTTGCTACCATTACTCGAGTAATGGTAGCAAGCAGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033194.1-614s1c1
Sequence:CCGGGCCATGATATACGAGGATCAACTCGAGTTGATCCTCGTATATCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-603s21c1
Sequence:CCGGCTCTACACTTGCCATGATATACTCGAGTATATCATGGCAAGTGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-500s21c1
Sequence:CCGGTCATGGGTGAAGCCAATATTCCTCGAGGAATATTGGCTTCACCCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033194.1-548s1c1
Sequence:CCGGGCCATATTGATGTGCATGGAACTCGAGTTCCATGCACATCAATATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033194.1-1927s1c1
Sequence:CCGGCCTTCTCTTAAAGGCCATATACTCGAGTATATGGCCTTTAAGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033194.2-2788s1c1
Sequence:CCGGCATCACTGCTTGCTACCATTACTCGAGTAATGGTAGCAAGCAGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033194.2-1073s21c1
Sequence:CCGGACAAAGCTTTGGAGGTAATTACTCGAGTAATTACCTCCAAAGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012086
VALIDATED
GTF3C3 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 3, 102kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-595s1c1
Sequence:CCGGGCGATATTGATGTGCATGGAACTCGAGTTCCATGCACATCAATATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-1801s1c1
Sequence:CCGGCGAGCCCAAGTTTGTTTGATACTCGAGTATCAAACAAACTTGGGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-2434s1c1
Sequence:CCGGGCATCTCAGAAGTATGTGTTACTCGAGTAACACATACTTCTGAGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-1648s1c1
Sequence:CCGGCCAGATACTTTAGCACAGGATCTCGAGATCCTGTGCTAAAGTATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-2760s1c1
Sequence:CCGGCGCAACTGAGAACAGAGCAATCTCGAGATTGCTCTGTTCTCAGTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012086.2-2757s21c1
Sequence:CCGGCGCAACTGAGAACAGAGCAATCTCGAGATTGCTCTGTTCTCAGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-1798s21c1
Sequence:CCGGCGAGCCCAAGTTTGTTTGATACTCGAGTATCAAACAAACTTGGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-1645s21c1
Sequence:CCGGCCAGATACTTTAGCACAGGATCTCGAGATCCTGTGCTAAAGTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-592s21c1
Sequence:CCGGGCGATATTGATGTGCATGGAACTCGAGTTCCATGCACATCAATATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-2431s21c1
Sequence:CCGGGCATCTCAGAAGTATGTGTTACTCGAGTAACACATACTTCTGAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012086
VALIDATED
GTF3C3 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 3, 102kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-595s1c1
Sequence:CCGGGCGATATTGATGTGCATGGAACTCGAGTTCCATGCACATCAATATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-1801s1c1
Sequence:CCGGCGAGCCCAAGTTTGTTTGATACTCGAGTATCAAACAAACTTGGGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-2434s1c1
Sequence:CCGGGCATCTCAGAAGTATGTGTTACTCGAGTAACACATACTTCTGAGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-1648s1c1
Sequence:CCGGCCAGATACTTTAGCACAGGATCTCGAGATCCTGTGCTAAAGTATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-2760s1c1
Sequence:CCGGCGCAACTGAGAACAGAGCAATCTCGAGATTGCTCTGTTCTCAGTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012086.2-2757s21c1
Sequence:CCGGCGCAACTGAGAACAGAGCAATCTCGAGATTGCTCTGTTCTCAGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-1798s21c1
Sequence:CCGGCGAGCCCAAGTTTGTTTGATACTCGAGTATCAAACAAACTTGGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-1645s21c1
Sequence:CCGGCCAGATACTTTAGCACAGGATCTCGAGATCCTGTGCTAAAGTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-592s21c1
Sequence:CCGGGCGATATTGATGTGCATGGAACTCGAGTTCCATGCACATCAATATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-2431s21c1
Sequence:CCGGGCATCTCAGAAGTATGTGTTACTCGAGTAACACATACTTCTGAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012086
VALIDATED
GTF3C3 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 3, 102kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-595s1c1
Sequence:CCGGGCGATATTGATGTGCATGGAACTCGAGTTCCATGCACATCAATATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-1801s1c1
Sequence:CCGGCGAGCCCAAGTTTGTTTGATACTCGAGTATCAAACAAACTTGGGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-2434s1c1
Sequence:CCGGGCATCTCAGAAGTATGTGTTACTCGAGTAACACATACTTCTGAGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-1648s1c1
Sequence:CCGGCCAGATACTTTAGCACAGGATCTCGAGATCCTGTGCTAAAGTATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012086.1-2760s1c1
Sequence:CCGGCGCAACTGAGAACAGAGCAATCTCGAGATTGCTCTGTTCTCAGTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012086.2-2757s21c1
Sequence:CCGGCGCAACTGAGAACAGAGCAATCTCGAGATTGCTCTGTTCTCAGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-1798s21c1
Sequence:CCGGCGAGCCCAAGTTTGTTTGATACTCGAGTATCAAACAAACTTGGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-1645s21c1
Sequence:CCGGCCAGATACTTTAGCACAGGATCTCGAGATCCTGTGCTAAAGTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-592s21c1
Sequence:CCGGGCGATATTGATGTGCATGGAACTCGAGTTCCATGCACATCAATATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012086.2-2431s21c1
Sequence:CCGGGCATCTCAGAAGTATGTGTTACTCGAGTAACACATACTTCTGAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)