EMAIL THIS PAGE TO A FRIEND

GTF3C4

general transcription factor IIIC, polypeptide 4, 90kDa

49 Gene Product Result for
Synonyms: KAT12 TFIII90 TFIIIC290 TFIIIC90 TFIIICDELTA
UniProtKB ID: Q9UKN8, Q5VZJ7
Gene ID:
Mouse(269252) general transcription factor IIIC, polypeptide 4
Rat(685539) general transcription factor IIIC, polypeptide 4
domestic guinea pig(100715700) general transcription factor IIIC, polypeptide 4, 90kDa
naked mole-rat(101709731) general transcription factor IIIC, polypeptide 4, 90kDa
sheep(101119386) general transcription factor IIIC, polypeptide 4, 90kDa
Domestic Rabbit(100337935) general transcription factor IIIC, polypeptide 4, 90kDa
Zebrafish(568510) general transcription factor IIIC, polypeptide 4
chicken(417167) general transcription factor IIIC, polypeptide 4, 90kDa
dog(608418) general transcription factor IIIC, polypeptide 4, 90kDa
Horse(100069446) general transcription factor IIIC, polypeptide 4, 90kDa
cow(540249) general transcription factor IIIC, polypeptide 4, 90kDa
domestic cat(101101007) general transcription factor IIIC, polypeptide 4, 90kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012204 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012204 Rosetta Predictions human pricing
NM_001109473 Rosetta Predictions rat pricing
NM_172977 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233144 predicted 2667
2 SASI_Hs01_00233145 predicted 2475
3 SASI_Hs02_00343857 predicted 1661
4 SASI_Hs01_00233146 predicted 1554
5 SASI_Hs01_00233147 predicted 1211
6 SASI_Hs01_00233148 predicted 1403
7 SASI_Hs01_00233149 predicted 1782
8 SASI_Hs01_00233150 predicted 1113
9 SASI_Hs02_00343858 predicted 2649
10 SASI_Hs01_00233151 predicted 2296
11 SASI_Hs01_00233152 predicted 2316
12 SASI_Hs01_00233153 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248747 predicted 2349
2 SASI_Rn02_00248748 predicted 1078
3 SASI_Rn02_00248749 predicted 1285
4 SASI_Rn02_00248750 predicted 2245
5 SASI_Rn02_00248751 predicted 1549
6 SASI_Rn02_00248752 predicted 1248
7 SASI_Rn02_00248753 predicted 938
8 SASI_Rn02_00248754 predicted 709
9 SASI_Rn02_00248755 predicted 2512
10 SASI_Rn02_00248756 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114950 predicted 2289
2 SASI_Mm02_00345025 predicted 2325
3 SASI_Mm01_00114951 predicted 2185
4 SASI_Mm01_00114952 predicted 2525
5 SASI_Mm01_00114953 predicted 1159
6 SASI_Mm01_00114954 predicted 1630
7 SASI_Mm01_00114956 predicted 682
8 SASI_Mm01_00114957 predicted 880
9 SASI_Mm01_00114958 predicted 1191
10 SASI_Mm01_00114959 predicted 2449
11 SASI_Mm01_00114955 predicted 2154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172977
VALIDATED
GTF3C4 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 4, 90kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-3160s1c1
Sequence:CCGGGCCCAGCTCTTTAATATGTAACTCGAGTTACATATTAAAGAGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-882s1c1
Sequence:CCGGCCTCTTTGAGAACGGGAATATCTCGAGATATTCCCGTTCTCAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172977.1-2224s1c1
Sequence:CCGGGCACAGGTCTTGATTGGACATCTCGAGATGTCCAATCAAGACCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-691s1c1
Sequence:CCGGCGTCTTTATGAGACTAGTTATCTCGAGATAACTAGTCTCATAAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-1273s1c1
Sequence:CCGGGCAGGTCTGAATGTTCACAATCTCGAGATTGTGAACATTCAGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172977.2-690s21c1
Sequence:CCGGCGTCTTTATGAGACTAGTTATCTCGAGATAACTAGTCTCATAAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172977.2-1272s21c1
Sequence:CCGGGCAGGTCTGAATGTTCACAATCTCGAGATTGTGAACATTCAGACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172977.2-3159s21c1
Sequence:CCGGGCCCAGCTCTTTAATATGTAACTCGAGTTACATATTAAAGAGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172977.2-2223s21c1
Sequence:CCGGGCACAGGTCTTGATTGGACATCTCGAGATGTCCAATCAAGACCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172977
VALIDATED
GTF3C4 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 4, 90kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-3160s1c1
Sequence:CCGGGCCCAGCTCTTTAATATGTAACTCGAGTTACATATTAAAGAGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-882s1c1
Sequence:CCGGCCTCTTTGAGAACGGGAATATCTCGAGATATTCCCGTTCTCAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172977.1-2224s1c1
Sequence:CCGGGCACAGGTCTTGATTGGACATCTCGAGATGTCCAATCAAGACCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-691s1c1
Sequence:CCGGCGTCTTTATGAGACTAGTTATCTCGAGATAACTAGTCTCATAAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-1273s1c1
Sequence:CCGGGCAGGTCTGAATGTTCACAATCTCGAGATTGTGAACATTCAGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172977.2-690s21c1
Sequence:CCGGCGTCTTTATGAGACTAGTTATCTCGAGATAACTAGTCTCATAAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172977.2-1272s21c1
Sequence:CCGGGCAGGTCTGAATGTTCACAATCTCGAGATTGTGAACATTCAGACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172977.2-3159s21c1
Sequence:CCGGGCCCAGCTCTTTAATATGTAACTCGAGTTACATATTAAAGAGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172977.2-2223s21c1
Sequence:CCGGGCACAGGTCTTGATTGGACATCTCGAGATGTCCAATCAAGACCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172977
VALIDATED
GTF3C4 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 4, 90kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-3160s1c1
Sequence:CCGGGCCCAGCTCTTTAATATGTAACTCGAGTTACATATTAAAGAGCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-882s1c1
Sequence:CCGGCCTCTTTGAGAACGGGAATATCTCGAGATATTCCCGTTCTCAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172977.1-2224s1c1
Sequence:CCGGGCACAGGTCTTGATTGGACATCTCGAGATGTCCAATCAAGACCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-691s1c1
Sequence:CCGGCGTCTTTATGAGACTAGTTATCTCGAGATAACTAGTCTCATAAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172977.1-1273s1c1
Sequence:CCGGGCAGGTCTGAATGTTCACAATCTCGAGATTGTGAACATTCAGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172977.2-690s21c1
Sequence:CCGGCGTCTTTATGAGACTAGTTATCTCGAGATAACTAGTCTCATAAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172977.2-1272s21c1
Sequence:CCGGGCAGGTCTGAATGTTCACAATCTCGAGATTGTGAACATTCAGACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172977.2-3159s21c1
Sequence:CCGGGCCCAGCTCTTTAATATGTAACTCGAGTTACATATTAAAGAGCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172977.2-2223s21c1
Sequence:CCGGGCACAGGTCTTGATTGGACATCTCGAGATGTCCAATCAAGACCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012204
VALIDATED
GTF3C4 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 4, 90kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012204.1-3041s1c1
Sequence:CCGGCGTCATTTCTAGAAACAGAATCTCGAGATTCTGTTTCTAGAAATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012204.1-2588s1c1
Sequence:CCGGCCTGCCAGAGTTTGATATATACTCGAGTATATATCAAACTCTGGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012204.1-1029s1c1
Sequence:CCGGCCAGCAGGTCAAGCATAACAACTCGAGTTGTTATGCTTGACCTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_012204.1-1148s1c1
Sequence:CCGGCCATCTCTTCATGCAACACAACTCGAGTTGTGTTGCATGAAGAGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012204.1-2319s1c1
Sequence:CCGGGCCAGTCTTAGGAGAAGTGTACTCGAGTACACTTCTCCTAAGACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-2439s21c1
Sequence:CCGGACGGGTGCTGATTGGACATATCTCGAGATATGTCCAATCAGCACCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-1109s21c1
Sequence:CCGGATATCGCCGTGTGGCAGTTTCCTCGAGGAAACTGCCACACGGCGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-1640s21c1
Sequence:CCGGTTGAACACCAGTTGATTAAACCTCGAGGTTTAATCAACTGGTGTTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-913s21c1
Sequence:CCGGACCAGTTACAGGCTCTCTAAACTCGAGTTTAGAGAGCCTGTAACTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012204.2-2986s21c1
Sequence:CCGGCAATGAGGAACACTTACTTATCTCGAGATAAGTAAGTGTTCCTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012204
VALIDATED
GTF3C4 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 4, 90kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012204.1-3041s1c1
Sequence:CCGGCGTCATTTCTAGAAACAGAATCTCGAGATTCTGTTTCTAGAAATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012204.1-2588s1c1
Sequence:CCGGCCTGCCAGAGTTTGATATATACTCGAGTATATATCAAACTCTGGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012204.1-1029s1c1
Sequence:CCGGCCAGCAGGTCAAGCATAACAACTCGAGTTGTTATGCTTGACCTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_012204.1-1148s1c1
Sequence:CCGGCCATCTCTTCATGCAACACAACTCGAGTTGTGTTGCATGAAGAGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012204.1-2319s1c1
Sequence:CCGGGCCAGTCTTAGGAGAAGTGTACTCGAGTACACTTCTCCTAAGACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-2439s21c1
Sequence:CCGGACGGGTGCTGATTGGACATATCTCGAGATATGTCCAATCAGCACCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-1109s21c1
Sequence:CCGGATATCGCCGTGTGGCAGTTTCCTCGAGGAAACTGCCACACGGCGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-1640s21c1
Sequence:CCGGTTGAACACCAGTTGATTAAACCTCGAGGTTTAATCAACTGGTGTTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-913s21c1
Sequence:CCGGACCAGTTACAGGCTCTCTAAACTCGAGTTTAGAGAGCCTGTAACTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012204.2-2986s21c1
Sequence:CCGGCAATGAGGAACACTTACTTATCTCGAGATAAGTAAGTGTTCCTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012204
VALIDATED
GTF3C4 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 4, 90kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_012204.1-3041s1c1
Sequence:CCGGCGTCATTTCTAGAAACAGAATCTCGAGATTCTGTTTCTAGAAATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012204.1-2588s1c1
Sequence:CCGGCCTGCCAGAGTTTGATATATACTCGAGTATATATCAAACTCTGGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012204.1-1029s1c1
Sequence:CCGGCCAGCAGGTCAAGCATAACAACTCGAGTTGTTATGCTTGACCTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_012204.1-1148s1c1
Sequence:CCGGCCATCTCTTCATGCAACACAACTCGAGTTGTGTTGCATGAAGAGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_012204.1-2319s1c1
Sequence:CCGGGCCAGTCTTAGGAGAAGTGTACTCGAGTACACTTCTCCTAAGACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-2439s21c1
Sequence:CCGGACGGGTGCTGATTGGACATATCTCGAGATATGTCCAATCAGCACCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-1109s21c1
Sequence:CCGGATATCGCCGTGTGGCAGTTTCCTCGAGGAAACTGCCACACGGCGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-1640s21c1
Sequence:CCGGTTGAACACCAGTTGATTAAACCTCGAGGTTTAATCAACTGGTGTTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012204.2-913s21c1
Sequence:CCGGACCAGTTACAGGCTCTCTAAACTCGAGTTTAGAGAGCCTGTAACTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012204.2-2986s21c1
Sequence:CCGGCAATGAGGAACACTTACTTATCTCGAGATAAGTAAGTGTTCCTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)