EMAIL THIS PAGE TO A FRIEND

GTF3C5

general transcription factor IIIC, polypeptide 5, 63kDa

68 Gene Product Result for
Synonyms: TFIIIC63 TFIIICepsilon TFiiiC2-63
Gene ID:
Mouse(70239) general transcription factor IIIC, polypeptide 5
Rat(362095) general transcription factor IIIC, polypeptide 5
Zebrafish(565198) general transcription factor IIIC, polypeptide 5
cow(783869) general transcription factor IIIC, polypeptide 5, 63kDa
Horse(100069412) general transcription factor IIIC, polypeptide 5, 63kDa
domestic cat(101080334) general transcription factor IIIC, polypeptide 5, 63kDa
dog(480687) general transcription factor IIIC, polypeptide 5, 63kDa
chicken(417164) general transcription factor IIIC, polypeptide 5, 63kDa
sheep(101112549) general transcription factor IIIC, polypeptide 5, 63kDa
domestic guinea pig(100726944) general transcription factor IIIC, polypeptide 5, 63kDa
naked mole-rat(101701962) general transcription factor IIIC, polypeptide 5, 63kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012087 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046801 MISSION® esiRNA esiRNA targeting mouse Gtf3c5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122823 Rosetta Predictions human pricing
NM_012087 Rosetta Predictions human pricing
NM_001079941 Rosetta Predictions rat pricing
NM_148928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327367 predicted 1189
2 SASI_Hs02_00327368 predicted 1231
3 SASI_Hs02_00327369 predicted 1260
4 SASI_Hs02_00327370 predicted 554
5 SASI_Hs02_00327371 predicted 2066
6 SASI_Hs02_00327372 predicted 672
7 SASI_Hs02_00327373 predicted 2180
8 SASI_Hs02_00327374 predicted 1187
9 SASI_Hs02_00327375 predicted 1226
10 SASI_Hs02_00327376 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343571 predicted 1181
2 SASI_Hs01_00236796 predicted 1224
3 SASI_Hs01_00236797 predicted 1264
4 SASI_Hs01_00236798 predicted 545
5 SASI_Hs02_00343572 predicted 2045
6 SASI_Hs01_00236800 predicted 679
7 SASI_Hs02_00343573 predicted 2155
8 SASI_Hs02_00343574 predicted 1191
9 SASI_Hs02_00343575 predicted 1227
10 SASI_Hs02_00343576 predicted 452
11 SASI_Hs01_00236799 predicted 1497
12 SASI_Hs01_00236801 predicted 1440
13 SASI_Hs01_00236802 predicted 1457
14 SASI_Hs01_00236803 predicted 736
15 SASI_Hs01_00236804 predicted 1410
16 SASI_Hs01_00236805 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208359 predicted 1041
2 SASI_Rn02_00208360 predicted 1093
3 SASI_Rn02_00208361 predicted 604
4 SASI_Rn02_00208362 predicted 877
5 SASI_Rn02_00208363 predicted 1135
6 SASI_Rn02_00208364 predicted 897
7 SASI_Rn02_00208365 predicted 1073
8 SASI_Rn02_00208366 predicted 1388
9 SASI_Rn02_00208367 predicted 1200
10 SASI_Rn02_00208368 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140139 predicted 1089
2 SASI_Mm01_00140140 predicted 1152
3 SASI_Mm01_00140141 predicted 1419
4 SASI_Mm01_00140145 predicted 461
5 SASI_Mm02_00342737 predicted 667
6 SASI_Mm02_00342738 predicted 615
7 SASI_Mm01_00140146 predicted 1308
8 SASI_Mm01_00140147 predicted 1189
9 SASI_Mm01_00140148 predicted 757
10 SASI_Mm02_00342739 predicted 1443
11 SASI_Mm01_00140142 predicted 1408
12 SASI_Mm01_00140143 predicted 637
13 SASI_Mm01_00140144 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148928
VALIDATED
GTF3C5 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 5, 63kDa
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-625s21c1
Sequence:CCGGCGTTCAACTTGGAGATCATTGCTCGAGCAATGATCTCCAAGTTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148928.2-1083s21c1
Sequence:CCGGCGTCCTGTTTGGTCACGAAATCTCGAGATTTCGTGACCAAACAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-2212s21c1
Sequence:CCGGAGATTGAAGATCCATTGTTTGCTCGAGCAAACAATGGATCTTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-1436s21c1
Sequence:CCGGACGGAAATTGACCTACAATAACTCGAGTTATTGTAGGTCAATTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148928.2-869s21c1
Sequence:CCGGGCACCGAGAAGGCTATCATAACTCGAGTTATGATAGCCTTCTCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-1192s21c1
Sequence:CCGGGAAGCTTGTGGATTCGATTTGCTCGAGCAAATCGAATCCACAAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148928.1-2190s1c1
Sequence:CCGGCCATTGTTTGATTTGGGTCAACTCGAGTTGACCCAAATCAAACAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148928.1-1118s1c1
Sequence:CCGGGCTTCCCTATATGGCTTATTACTCGAGTAATAAGCCATATAGGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148928.1-1050s1c1
Sequence:CCGGCGTCCTGTTTGGTCACGAAATCTCGAGATTTCGTGACCAAACAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148928.1-1049s1c1
Sequence:CCGGCCGTCCTGTTTGGTCACGAAACTCGAGTTTCGTGACCAAACAGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148928.1-1206s1c1
Sequence:CCGGGCCAAGATTTATCAAGTCCTTCTCGAGAAGGACTTGATAAATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148928
VALIDATED
GTF3C5 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 5, 63kDa
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-625s21c1
Sequence:CCGGCGTTCAACTTGGAGATCATTGCTCGAGCAATGATCTCCAAGTTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148928.2-1083s21c1
Sequence:CCGGCGTCCTGTTTGGTCACGAAATCTCGAGATTTCGTGACCAAACAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-2212s21c1
Sequence:CCGGAGATTGAAGATCCATTGTTTGCTCGAGCAAACAATGGATCTTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-1436s21c1
Sequence:CCGGACGGAAATTGACCTACAATAACTCGAGTTATTGTAGGTCAATTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148928.2-869s21c1
Sequence:CCGGGCACCGAGAAGGCTATCATAACTCGAGTTATGATAGCCTTCTCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-1192s21c1
Sequence:CCGGGAAGCTTGTGGATTCGATTTGCTCGAGCAAATCGAATCCACAAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148928.1-2190s1c1
Sequence:CCGGCCATTGTTTGATTTGGGTCAACTCGAGTTGACCCAAATCAAACAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148928.1-1118s1c1
Sequence:CCGGGCTTCCCTATATGGCTTATTACTCGAGTAATAAGCCATATAGGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148928.1-1050s1c1
Sequence:CCGGCGTCCTGTTTGGTCACGAAATCTCGAGATTTCGTGACCAAACAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148928.1-1049s1c1
Sequence:CCGGCCGTCCTGTTTGGTCACGAAACTCGAGTTTCGTGACCAAACAGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148928.1-1206s1c1
Sequence:CCGGGCCAAGATTTATCAAGTCCTTCTCGAGAAGGACTTGATAAATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148928
VALIDATED
GTF3C5 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 5, 63kDa
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-625s21c1
Sequence:CCGGCGTTCAACTTGGAGATCATTGCTCGAGCAATGATCTCCAAGTTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148928.2-1083s21c1
Sequence:CCGGCGTCCTGTTTGGTCACGAAATCTCGAGATTTCGTGACCAAACAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-2212s21c1
Sequence:CCGGAGATTGAAGATCCATTGTTTGCTCGAGCAAACAATGGATCTTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-1436s21c1
Sequence:CCGGACGGAAATTGACCTACAATAACTCGAGTTATTGTAGGTCAATTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148928.2-869s21c1
Sequence:CCGGGCACCGAGAAGGCTATCATAACTCGAGTTATGATAGCCTTCTCGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_148928.2-1192s21c1
Sequence:CCGGGAAGCTTGTGGATTCGATTTGCTCGAGCAAATCGAATCCACAAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_148928.1-2190s1c1
Sequence:CCGGCCATTGTTTGATTTGGGTCAACTCGAGTTGACCCAAATCAAACAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148928.1-1118s1c1
Sequence:CCGGGCTTCCCTATATGGCTTATTACTCGAGTAATAAGCCATATAGGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148928.1-1050s1c1
Sequence:CCGGCGTCCTGTTTGGTCACGAAATCTCGAGATTTCGTGACCAAACAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_148928.1-1049s1c1
Sequence:CCGGCCGTCCTGTTTGGTCACGAAACTCGAGTTTCGTGACCAAACAGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148928.1-1206s1c1
Sequence:CCGGGCCAAGATTTATCAAGTCCTTCTCGAGAAGGACTTGATAAATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012087
VALIDATED
GTF3C5 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 5, 63kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-1547s21c1
Sequence:CCGGCGGCAGATGTTCTACCAGTTACTCGAGTAACTGGTAGAACATCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-2185s21c1
Sequence:CCGGTCTCAGGATGAGACCAGTAAACTCGAGTTTACTGGTCTCATCCTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-1300s21c1
Sequence:CCGGCCGAATCCGTTGTGGAATGAACTCGAGTTCATTCCACAACGGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-981s21c1
Sequence:CCGGATGCCATCTTTGTCAACTTTGCTCGAGCAAAGTTGACAAAGATGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012087.3-1187s21c1
Sequence:CCGGCTTCCCTTCATAGCCTATTACCTCGAGGTAATAGGCTATGAAGGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012087.1-2053s1c1
Sequence:CCGGGTTAGGGACATCCCAAAGGTACTCGAGTACCTTTGGGATGTCCCTAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-1502s1c1
Sequence:CCGGCGGCAGATGTTCTACCAGTTACTCGAGTAACTGGTAGAACATCTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-709s1c1
Sequence:CCGGCGGCAAGCATACGTCAATGTACTCGAGTACATTGACGTATGCTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-1181s1c1
Sequence:CCGGCGCAGCCTATGGATTCGATTTCTCGAGAAATCGAATCCATAGGCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-1255s1c1
Sequence:CCGGCCGAATCCGTTGTGGAATGAACTCGAGTTCATTCCACAACGGATTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012087
VALIDATED
GTF3C5 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 5, 63kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-1547s21c1
Sequence:CCGGCGGCAGATGTTCTACCAGTTACTCGAGTAACTGGTAGAACATCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-2185s21c1
Sequence:CCGGTCTCAGGATGAGACCAGTAAACTCGAGTTTACTGGTCTCATCCTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-1300s21c1
Sequence:CCGGCCGAATCCGTTGTGGAATGAACTCGAGTTCATTCCACAACGGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-981s21c1
Sequence:CCGGATGCCATCTTTGTCAACTTTGCTCGAGCAAAGTTGACAAAGATGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012087.3-1187s21c1
Sequence:CCGGCTTCCCTTCATAGCCTATTACCTCGAGGTAATAGGCTATGAAGGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012087.1-2053s1c1
Sequence:CCGGGTTAGGGACATCCCAAAGGTACTCGAGTACCTTTGGGATGTCCCTAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-1502s1c1
Sequence:CCGGCGGCAGATGTTCTACCAGTTACTCGAGTAACTGGTAGAACATCTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-709s1c1
Sequence:CCGGCGGCAAGCATACGTCAATGTACTCGAGTACATTGACGTATGCTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-1181s1c1
Sequence:CCGGCGCAGCCTATGGATTCGATTTCTCGAGAAATCGAATCCATAGGCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-1255s1c1
Sequence:CCGGCCGAATCCGTTGTGGAATGAACTCGAGTTCATTCCACAACGGATTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012087
VALIDATED
GTF3C5 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 5, 63kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-1547s21c1
Sequence:CCGGCGGCAGATGTTCTACCAGTTACTCGAGTAACTGGTAGAACATCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274258    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-2185s21c1
Sequence:CCGGTCTCAGGATGAGACCAGTAAACTCGAGTTTACTGGTCTCATCCTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-1300s21c1
Sequence:CCGGCCGAATCCGTTGTGGAATGAACTCGAGTTCATTCCACAACGGATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012087.3-981s21c1
Sequence:CCGGATGCCATCTTTGTCAACTTTGCTCGAGCAAAGTTGACAAAGATGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012087.3-1187s21c1
Sequence:CCGGCTTCCCTTCATAGCCTATTACCTCGAGGTAATAGGCTATGAAGGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012087.1-2053s1c1
Sequence:CCGGGTTAGGGACATCCCAAAGGTACTCGAGTACCTTTGGGATGTCCCTAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-1502s1c1
Sequence:CCGGCGGCAGATGTTCTACCAGTTACTCGAGTAACTGGTAGAACATCTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-709s1c1
Sequence:CCGGCGGCAAGCATACGTCAATGTACTCGAGTACATTGACGTATGCTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-1181s1c1
Sequence:CCGGCGCAGCCTATGGATTCGATTTCTCGAGAAATCGAATCCATAGGCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012087.1-1255s1c1
Sequence:CCGGCCGAATCCGTTGTGGAATGAACTCGAGTTCATTCCACAACGGATTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)