EMAIL THIS PAGE TO A FRIEND

GTF3C6

general transcription factor IIIC, polypeptide 6, alpha 35kDa

50 Gene Product Result for
Synonyms: C6orf51 TFIIIC35 bA397G5.3
UniProtKB ID: Q969F1, Q5VXN2
Gene ID:
Human(112495) Summary: RNA polymerases are unable to initiate RNA synthesis in the absence of additional proteins called general transcription factors (GTFs). GTFs assemble in a complex on the DNA promoter and recruit the RNA polymerase. GTF3C family proteins (e.g., GTF3C1, MIM 603246) are essential for RNA polymerase III to make a number of small nuclear and cytoplasmic RNAs, including 5S RNA (MIM 180420), tRNA, and adenovirus-associated (VA) RNA of both cellular and viral origin.[supplied by OMIM, Mar 2008]
Mouse(67371) general transcription factor IIIC, polypeptide 6, alpha
Rat(361858) general transcription factor IIIC, polypeptide 6, alpha
domestic guinea pig(100719859) general transcription factor IIIC, polypeptide 6, alpha 35kDa
naked mole-rat(101710597) general transcription factor IIIC, polypeptide 6, alpha 35kDa
sheep(101110600) general transcription factor IIIC, polypeptide 6, alpha 35kDa
Zebrafish(393232) general transcription factor IIIC, polypeptide 6, alpha
cow(518472) general transcription factor IIIC, polypeptide 6, alpha 35kDa
domestic cat(101084363) general transcription factor IIIC, polypeptide 6, alpha 35kDa
dog(481961) general transcription factor IIIC, polypeptide 6, alpha 35kDa
chicken(421754) general transcription factor IIIC, polypeptide 6, alpha 35kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026113 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026113 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026113 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138408 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138408 Rosetta Predictions human pricing
NM_001108537 Rosetta Predictions rat pricing
NM_026113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021554 predicted 408
2 SASI_Hs01_00021555 predicted 413
3 SASI_Hs01_00021557 predicted 502
4 SASI_Hs02_00363549 predicted 523
5 SASI_Hs01_00021558 predicted 450
6 SASI_Hs02_00363550 predicted 361
7 SASI_Hs01_00021560 predicted 298
8 SASI_Hs01_00021561 predicted 407
9 SASI_Hs01_00021562 predicted 414
10 SASI_Hs01_00021563 predicted 448
11 SASI_Hs01_00021556 predicted 450
12 SASI_Hs01_00021559 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239619 predicted 935
2 SASI_Rn02_00239620 predicted 999
3 SASI_Rn02_00239621 predicted 1022
4 SASI_Rn02_00239622 predicted 1017
5 SASI_Rn02_00239623 predicted 1029
6 SASI_Rn02_00239624 predicted 941
7 SASI_Rn02_00239625 predicted 850
8 SASI_Rn02_00239626 predicted 1052
9 SASI_Rn02_00239627 predicted 1015
10 SASI_Rn02_00239628 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085124 predicted 514
2 SASI_Mm01_00085125 predicted 388
3 SASI_Mm01_00085126 predicted 652
4 SASI_Mm01_00085128 predicted 676
5 SASI_Mm02_00329689 predicted 681
6 SASI_Mm02_00329690 predicted 769
7 SASI_Mm01_00085129 predicted 519
8 SASI_Mm01_00085130 predicted 421
9 SASI_Mm01_00085131 predicted 339
10 SASI_Mm02_00329691 predicted 413
11 SASI_Mm01_00085127 predicted 506
12 SASI_Mm01_00085132 predicted 789
13 SASI_Mm01_00085133 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026113
VALIDATED
GTF3C6 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 6, alpha 35kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-104s21c1
Sequence:CCGGTAGAATTGTCAGGAATCATTGCTCGAGCAATGATTCCTGACAATTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026113.4-91s1c1
Sequence:CCGGCAGTTTGTTCTGGTAGAATTGCTCGAGCAATTCTACCAGAACAAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026113.4-738s21c1
Sequence:CCGGGCTCACCATCCCGTGTTATTTCTCGAGAAATAACACGGGATGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-404s21c1
Sequence:CCGGGGCTGCAAATGAAGGATAATGCTCGAGCATTATCCTTCATTTGCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026113.4-404s1c1
Sequence:CCGGGGCTGCAAATGAAGGATAATGCTCGAGCATTATCCTTCATTTGCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-431s21c1
Sequence:CCGGCCTATAGACCCAACATGATTTCTCGAGAAATCATGTTGGGTCTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-646s21c1
Sequence:CCGGATGGGAACTCAAGATGGAAATCTCGAGATTTCCATCTTGAGTTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026113.2-700s1c1
Sequence:CCGGGAAGTGGTCTTGTATGCAATTCTCGAGAATTGCATACAAGACCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026113.2-739s1c1
Sequence:CCGGGCTCACCATCCCGTGTTATTTCTCGAGAAATAACACGGGATGGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026113.2-238s1c1
Sequence:CCGGGCTTGGTACCTGTGTTATATTCTCGAGAATATAACACAGGTACCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026113
VALIDATED
GTF3C6 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 6, alpha 35kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-104s21c1
Sequence:CCGGTAGAATTGTCAGGAATCATTGCTCGAGCAATGATTCCTGACAATTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026113.4-91s1c1
Sequence:CCGGCAGTTTGTTCTGGTAGAATTGCTCGAGCAATTCTACCAGAACAAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026113.4-738s21c1
Sequence:CCGGGCTCACCATCCCGTGTTATTTCTCGAGAAATAACACGGGATGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-404s21c1
Sequence:CCGGGGCTGCAAATGAAGGATAATGCTCGAGCATTATCCTTCATTTGCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026113.4-404s1c1
Sequence:CCGGGGCTGCAAATGAAGGATAATGCTCGAGCATTATCCTTCATTTGCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-431s21c1
Sequence:CCGGCCTATAGACCCAACATGATTTCTCGAGAAATCATGTTGGGTCTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-646s21c1
Sequence:CCGGATGGGAACTCAAGATGGAAATCTCGAGATTTCCATCTTGAGTTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026113.2-700s1c1
Sequence:CCGGGAAGTGGTCTTGTATGCAATTCTCGAGAATTGCATACAAGACCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026113.2-739s1c1
Sequence:CCGGGCTCACCATCCCGTGTTATTTCTCGAGAAATAACACGGGATGGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026113.2-238s1c1
Sequence:CCGGGCTTGGTACCTGTGTTATATTCTCGAGAATATAACACAGGTACCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026113
VALIDATED
GTF3C6 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 6, alpha 35kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-104s21c1
Sequence:CCGGTAGAATTGTCAGGAATCATTGCTCGAGCAATGATTCCTGACAATTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026113.4-91s1c1
Sequence:CCGGCAGTTTGTTCTGGTAGAATTGCTCGAGCAATTCTACCAGAACAAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026113.4-738s21c1
Sequence:CCGGGCTCACCATCCCGTGTTATTTCTCGAGAAATAACACGGGATGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-404s21c1
Sequence:CCGGGGCTGCAAATGAAGGATAATGCTCGAGCATTATCCTTCATTTGCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026113.4-404s1c1
Sequence:CCGGGGCTGCAAATGAAGGATAATGCTCGAGCATTATCCTTCATTTGCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-431s21c1
Sequence:CCGGCCTATAGACCCAACATGATTTCTCGAGAAATCATGTTGGGTCTATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026113.4-646s21c1
Sequence:CCGGATGGGAACTCAAGATGGAAATCTCGAGATTTCCATCTTGAGTTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026113.2-700s1c1
Sequence:CCGGGAAGTGGTCTTGTATGCAATTCTCGAGAATTGCATACAAGACCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026113.2-739s1c1
Sequence:CCGGGCTCACCATCCCGTGTTATTTCTCGAGAAATAACACGGGATGGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026113.2-238s1c1
Sequence:CCGGGCTTGGTACCTGTGTTATATTCTCGAGAATATAACACAGGTACCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138408
VALIDATED
GTF3C6 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 6, alpha 35kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138408.1-380s1c1
Sequence:CCGGGAGAAGAAGGAAGGAGAAGAACTCGAGTTCTTCTCCTTCCTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-605s1c1
Sequence:CCGGGAAATAGAAGATTCTGGTCCTCTCGAGAGGACCAGAATCTTCTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-587s1c1
Sequence:CCGGGAGAAACCAATGCACTTGGAACTCGAGTTCCAAGTGCATTGGTTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-342s1c1
Sequence:CCGGCAATGAAGAAGCTCAGCATGACTCGAGTCATGCTGAGCTTCTTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-352s1c1
Sequence:CCGGGCTCAGCATGACAAGAACTCTCTCGAGAGAGTTCTTGTCATGCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-530s1c1
Sequence:CCGGGAATTGGAAGAGGAAGAGATTCTCGAGAATCTCTTCCTCTTCCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138408.1-336s1c1
Sequence:CCGGGCCATACAATGAAGAAGCTCACTCGAGTGAGCTTCTTCATTGTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138408.3-723s21c1
Sequence:CCGGCGACAGTTCAAACCTGAGTTGCTCGAGCAACTCAGGTTTGAACTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138408.3-272s21c1
Sequence:CCGGAGTTGGTTCTGGTGGAATTATCTCGAGATAATTCCACCAGAACCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138408
VALIDATED
GTF3C6 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 6, alpha 35kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138408.1-380s1c1
Sequence:CCGGGAGAAGAAGGAAGGAGAAGAACTCGAGTTCTTCTCCTTCCTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-605s1c1
Sequence:CCGGGAAATAGAAGATTCTGGTCCTCTCGAGAGGACCAGAATCTTCTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-587s1c1
Sequence:CCGGGAGAAACCAATGCACTTGGAACTCGAGTTCCAAGTGCATTGGTTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-342s1c1
Sequence:CCGGCAATGAAGAAGCTCAGCATGACTCGAGTCATGCTGAGCTTCTTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-352s1c1
Sequence:CCGGGCTCAGCATGACAAGAACTCTCTCGAGAGAGTTCTTGTCATGCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-530s1c1
Sequence:CCGGGAATTGGAAGAGGAAGAGATTCTCGAGAATCTCTTCCTCTTCCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138408.1-336s1c1
Sequence:CCGGGCCATACAATGAAGAAGCTCACTCGAGTGAGCTTCTTCATTGTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138408.3-723s21c1
Sequence:CCGGCGACAGTTCAAACCTGAGTTGCTCGAGCAACTCAGGTTTGAACTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138408.3-272s21c1
Sequence:CCGGAGTTGGTTCTGGTGGAATTATCTCGAGATAATTCCACCAGAACCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138408
VALIDATED
GTF3C6 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 6, alpha 35kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138408.1-380s1c1
Sequence:CCGGGAGAAGAAGGAAGGAGAAGAACTCGAGTTCTTCTCCTTCCTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-605s1c1
Sequence:CCGGGAAATAGAAGATTCTGGTCCTCTCGAGAGGACCAGAATCTTCTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-587s1c1
Sequence:CCGGGAGAAACCAATGCACTTGGAACTCGAGTTCCAAGTGCATTGGTTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-342s1c1
Sequence:CCGGCAATGAAGAAGCTCAGCATGACTCGAGTCATGCTGAGCTTCTTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-352s1c1
Sequence:CCGGGCTCAGCATGACAAGAACTCTCTCGAGAGAGTTCTTGTCATGCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138408.1-530s1c1
Sequence:CCGGGAATTGGAAGAGGAAGAGATTCTCGAGAATCTCTTCCTCTTCCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138408.1-336s1c1
Sequence:CCGGGCCATACAATGAAGAAGCTCACTCGAGTGAGCTTCTTCATTGTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138408.3-723s21c1
Sequence:CCGGCGACAGTTCAAACCTGAGTTGCTCGAGCAACTCAGGTTTGAACTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138408.3-272s21c1
Sequence:CCGGAGTTGGTTCTGGTGGAATTATCTCGAGATAATTCCACCAGAACCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)