EMAIL THIS PAGE TO A FRIEND

GTPBP10

GTP-binding protein 10 (putative)

65 Gene Product Result for
Synonyms: ObgH2
Gene ID:
Human(85865) Summary: Small G proteins, such as GTPBP10, act as molecular switches that play crucial roles in the regulation of fundamental cellular processes such as protein synthesis, nuclear transport, membrane trafficking, and signal transduction (Hirano et al., 2006 [PubMed 17054726]
Mouse(207704) GTP-binding protein 10 (putative)
Rat(312054) GTP-binding protein 10 (putative)
sheep(101112643) GTP-binding protein 10 (putative)
Domestic Rabbit(100328632) GTP-binding protein 10 (putative)
domestic guinea pig(100729940) GTP-binding protein 10 (putative)
naked mole-rat(101699530) GTP-binding protein 10 (putative)
Zebrafish(436727) GTP-binding protein 10 (putative)
cow(613957) GTP-binding protein 10 (putative)
Horse(100060295) GTP-binding protein 10 (putative)
domestic cat(101083252) GTP-binding protein 10 (putative)
dog(100683980) GTP-binding protein 10 (putative)
chicken(420544) GTP-binding protein 10 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033107 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042717 Rosetta Predictions human pricing
NM_033107 Rosetta Predictions human pricing
NM_001100815 Rosetta Predictions rat pricing
NM_153116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311069 predicted 702
2 SASI_Hs02_00311070 predicted 663
3 SASI_Hs02_00311071 predicted 634
4 SASI_Hs02_00311072 predicted 578
5 SASI_Hs02_00311073 predicted 495
6 SASI_Hs02_00311074 predicted 678
7 SASI_Hs02_00311075 predicted 638
8 SASI_Hs02_00311076 predicted 670
9 SASI_Hs02_00311077 predicted 602
10 SASI_Hs02_00311078 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360816 predicted 941
2 SASI_Hs02_00360817 predicted 904
3 SASI_Hs02_00360818 predicted 873
4 SASI_Hs01_00077113 predicted 820
5 SASI_Hs02_00360819 predicted 729
6 SASI_Hs02_00360820 predicted 919
7 SASI_Hs02_00360821 predicted 883
8 SASI_Hs02_00360822 predicted 904
9 SASI_Hs02_00360823 predicted 841
10 SASI_Hs02_00360824 predicted 841
11 SASI_Hs01_00077112 predicted 717
12 SASI_Hs01_00077114 predicted 647
13 SASI_Hs01_00077115 predicted 617
14 SASI_Hs01_00077116 predicted 633
15 SASI_Hs01_00077117 predicted 926
16 SASI_Hs01_00077118 predicted 588
17 SASI_Hs01_00077119 predicted 346
18 SASI_Hs01_00077120 predicted 701
19 SASI_Hs01_00077121 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210642 predicted 829
2 SASI_Rn02_00210643 predicted 620
3 SASI_Rn02_00210644 predicted 703
4 SASI_Rn02_00210645 predicted 773
5 SASI_Rn02_00210646 predicted 1044
6 SASI_Rn02_00210647 predicted 1004
7 SASI_Rn02_00210648 predicted 591
8 SASI_Rn02_00210649 predicted 721
9 SASI_Rn02_00210650 predicted 1257
10 SASI_Rn02_00210651 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179506 predicted 1218
2 SASI_Mm01_00179507 predicted 993
3 SASI_Mm01_00179508 predicted 1203
4 SASI_Mm01_00179509 predicted 793
5 SASI_Mm01_00179510 predicted 658
6 SASI_Mm01_00179511 predicted 1094
7 SASI_Mm01_00179513 predicted 679
8 SASI_Mm01_00179514 predicted 1073
9 SASI_Mm01_00179515 predicted 1029
10 SASI_Mm02_00342973 predicted 548
11 SASI_Mm01_00179512 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153116
GTPBP10 MISSION shRNA Bacterial Glycerol Stock
GTP-binding protein 10 (putative)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-557s21c1
Sequence:CCGGTGATTGCAGATTATGCGTTTACTCGAGTAAACGCATAATCTGCAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-349s21c1
Sequence:CCGGGTGCTAGGAGAACTCAATAAACTCGAGTTTATTGAGTTCTCCTAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-850s21c1
Sequence:CCGGCCCGCACTCTTAGCAATTAATCTCGAGATTAATTGCTAAGAGTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153116.1-686s1c1
Sequence:CCGGGCCACAAGTTCCTCAAGCATTCTCGAGAATGCTTGAGGAACTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153116.1-1857s21c1
Sequence:CCGGTCCTGATGTGGGTACTAATTACTCGAGTAATTAGTACCCACATCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-880s21c1
Sequence:CCGGTTGCCGGATGCCCAAGTTAAACTCGAGTTTAACTTGGGCATCCGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153116.1-889s1c1
Sequence:CCGGGCCCAAGTTAAACTTCAGGAACTCGAGTTCCTGAAGTTTAACTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153116.1-453s1c1
Sequence:CCGGCATAGTTCACCTTGACCTAAACTCGAGTTTAGGTCAAGGTGAACTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153116
GTPBP10 MISSION shRNA shRNA Plasmid DNA
GTP-binding protein 10 (putative)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-557s21c1
Sequence:CCGGTGATTGCAGATTATGCGTTTACTCGAGTAAACGCATAATCTGCAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-349s21c1
Sequence:CCGGGTGCTAGGAGAACTCAATAAACTCGAGTTTATTGAGTTCTCCTAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-850s21c1
Sequence:CCGGCCCGCACTCTTAGCAATTAATCTCGAGATTAATTGCTAAGAGTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153116.1-686s1c1
Sequence:CCGGGCCACAAGTTCCTCAAGCATTCTCGAGAATGCTTGAGGAACTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153116.1-1857s21c1
Sequence:CCGGTCCTGATGTGGGTACTAATTACTCGAGTAATTAGTACCCACATCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-880s21c1
Sequence:CCGGTTGCCGGATGCCCAAGTTAAACTCGAGTTTAACTTGGGCATCCGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153116.1-889s1c1
Sequence:CCGGGCCCAAGTTAAACTTCAGGAACTCGAGTTCCTGAAGTTTAACTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153116.1-453s1c1
Sequence:CCGGCATAGTTCACCTTGACCTAAACTCGAGTTTAGGTCAAGGTGAACTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153116
GTPBP10 MISSION shRNA Lentiviral Transduction Particles
GTP-binding protein 10 (putative)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-557s21c1
Sequence:CCGGTGATTGCAGATTATGCGTTTACTCGAGTAAACGCATAATCTGCAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-349s21c1
Sequence:CCGGGTGCTAGGAGAACTCAATAAACTCGAGTTTATTGAGTTCTCCTAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-850s21c1
Sequence:CCGGCCCGCACTCTTAGCAATTAATCTCGAGATTAATTGCTAAGAGTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153116.1-686s1c1
Sequence:CCGGGCCACAAGTTCCTCAAGCATTCTCGAGAATGCTTGAGGAACTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153116.1-1857s21c1
Sequence:CCGGTCCTGATGTGGGTACTAATTACTCGAGTAATTAGTACCCACATCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153116.1-880s21c1
Sequence:CCGGTTGCCGGATGCCCAAGTTAAACTCGAGTTTAACTTGGGCATCCGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153116.1-889s1c1
Sequence:CCGGGCCCAAGTTAAACTTCAGGAACTCGAGTTCCTGAAGTTTAACTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153116.1-453s1c1
Sequence:CCGGCATAGTTCACCTTGACCTAAACTCGAGTTTAGGTCAAGGTGAACTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033107
GTPBP10 MISSION shRNA Bacterial Glycerol Stock
GTP-binding protein 10 (putative)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000148176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033107.1-1625s1c1
Sequence:CCGGGCCATTCCACAATGTATAGATCTCGAGATCTATACATTGTGGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033107.1-693s1c1
Sequence:CCGGGAGCACATATGAACAAAGGAACTCGAGTTCCTTTGTTCATATGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033107.1-103s1c1
Sequence:CCGGCGGAAATTTCATCGATAAGCTCTCGAGAGCTTATCGATGAAATTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033107.1-1382s1c1
Sequence:CCGGGAACTCATAGAAGGAGAGAATCTCGAGATTCTCTCCTTCTATGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033107
GTPBP10 MISSION shRNA shRNA Plasmid DNA
GTP-binding protein 10 (putative)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000148176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033107.1-1625s1c1
Sequence:CCGGGCCATTCCACAATGTATAGATCTCGAGATCTATACATTGTGGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033107.1-693s1c1
Sequence:CCGGGAGCACATATGAACAAAGGAACTCGAGTTCCTTTGTTCATATGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033107.1-103s1c1
Sequence:CCGGCGGAAATTTCATCGATAAGCTCTCGAGAGCTTATCGATGAAATTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033107.1-1382s1c1
Sequence:CCGGGAACTCATAGAAGGAGAGAATCTCGAGATTCTCTCCTTCTATGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033107
GTPBP10 MISSION shRNA Lentiviral Transduction Particles
GTP-binding protein 10 (putative)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000148176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033107.1-1625s1c1
Sequence:CCGGGCCATTCCACAATGTATAGATCTCGAGATCTATACATTGTGGAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033107.1-693s1c1
Sequence:CCGGGAGCACATATGAACAAAGGAACTCGAGTTCCTTTGTTCATATGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033107.1-103s1c1
Sequence:CCGGCGGAAATTTCATCGATAAGCTCTCGAGAGCTTATCGATGAAATTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033107.1-1382s1c1
Sequence:CCGGGAACTCATAGAAGGAGAGAATCTCGAGATTCTCTCCTTCTATGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)