EMAIL THIS PAGE TO A FRIEND

GTPBP1

GTP binding protein 1

114 Gene Product Result for
Synonyms: GP-1 GP1 HSPC018
UniProtKB ID: O00178, Q6IC67
Gene ID:
Human(9567) Summary: This gene is upregulated by interferon-gamma and encodes a protein that is a member of the AGP11/GTPBP1 family of GTP-binding proteins. A structurally similar protein has been found in mouse, where disruption of the gene for that protein had no observable phenotype. [provided by RefSeq, Jul 2008]
Mouse(14904) GTP binding protein 1
Rat(300077) GTP binding protein 1
Zebrafish(378721) GTP binding protein 1
domestic cat(101081908) GTP binding protein 1
cow(513922) GTP binding protein 1
Horse(100147081) GTP binding protein 1
dog(474506) GTP binding protein 1
chicken(418022) GTP binding protein 1
domestic guinea pig(100729912) GTP binding protein 1
naked mole-rat(101703464) GTP binding protein 1
sheep(101122185) GTP binding protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004286 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013818 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013818 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013818 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004286 Rosetta Predictions human pricing
NM_001130496 Rosetta Predictions rat pricing
NM_013818 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232438 predicted 1043
2 SASI_Hs01_00232439 predicted 732
3 SASI_Hs01_00232440 predicted 1332
4 SASI_Hs01_00232441 predicted 1055
5 SASI_Hs01_00232442 predicted 732
6 SASI_Hs01_00232443 predicted 507
7 SASI_Hs01_00232444 predicted 1767
8 SASI_Hs02_00337277 predicted 874
9 SASI_Hs01_00232445 predicted 1231
10 SASI_Hs01_00232446 predicted 1719
11 SASI_Hs01_00232437 predicted 1795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255389 predicted 440
2 SASI_Rn02_00255390 predicted 448
3 SASI_Rn02_00255391 predicted 525
4 SASI_Rn02_00255392 predicted 579
5 SASI_Rn02_00255393 predicted 451
6 SASI_Rn02_00255394 predicted 483
7 SASI_Rn02_00255395 predicted 488
8 SASI_Rn02_00255396 predicted 447
9 SASI_Rn02_00255397 predicted 440
10 SASI_Rn02_00255398 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013818 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181979 predicted 1573
2 SASI_Mm01_00181980 predicted 1644
3 SASI_Mm01_00181981 predicted 405
4 SASI_Mm02_00322785 predicted 1475
5 SASI_Mm01_00181982 predicted 614
6 SASI_Mm01_00181983 predicted 439
7 SASI_Mm01_00181985 predicted 1530
8 SASI_Mm01_00181986 predicted 1262
9 SASI_Mm01_00181987 predicted 1088
10 SASI_Mm01_00181988 predicted 455
11 SASI_Mm01_00181984 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004286
VALIDATED
GTPBP1 MISSION shRNA Bacterial Glycerol Stock
GTP binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004286.3-2808s1c1
Sequence:CCGGCTTGGAGACAATCCTGCGTTTCTCGAGAAACGCAGGATTGTCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004286.3-884s1c1
Sequence:CCGGGCACTCAATGTACCTGTCTTTCTCGAGAAAGACAGGTACATTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004286.3-1015s1c1
Sequence:CCGGGCAGAGCAAAGATGATGTGATCTCGAGATCACATCATCTTTGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004286.3-362s1c1
Sequence:CCGGGCGGAACAGATAGAGGCCGATCTCGAGATCGGCCTCTATCTGTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004286.3-1291s1c1
Sequence:CCGGCTTGGGTAACTTCCTGTCCATCTCGAGATGGACAGGAAGTTACCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-419s21c1
Sequence:CCGGGGATGCGGAGAGACCATATATCTCGAGATATATGGTCTCTCCGCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-1904s21c1
Sequence:CCGGTCCAAGCCGCAGCAGATTAAACTCGAGTTTAATCTGCTGCGGCTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-2970s21c1
Sequence:CCGGCTTGGAGACAATCCTGCGTTTCTCGAGAAACGCAGGATTGTCTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-1046s21c1
Sequence:CCGGGCACTCAATGTACCTGTCTTTCTCGAGAAAGACAGGTACATTGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004286
VALIDATED
GTPBP1 MISSION shRNA shRNA Plasmid DNA
GTP binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004286.3-2808s1c1
Sequence:CCGGCTTGGAGACAATCCTGCGTTTCTCGAGAAACGCAGGATTGTCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004286.3-884s1c1
Sequence:CCGGGCACTCAATGTACCTGTCTTTCTCGAGAAAGACAGGTACATTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004286.3-1015s1c1
Sequence:CCGGGCAGAGCAAAGATGATGTGATCTCGAGATCACATCATCTTTGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004286.3-362s1c1
Sequence:CCGGGCGGAACAGATAGAGGCCGATCTCGAGATCGGCCTCTATCTGTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004286.3-1291s1c1
Sequence:CCGGCTTGGGTAACTTCCTGTCCATCTCGAGATGGACAGGAAGTTACCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-419s21c1
Sequence:CCGGGGATGCGGAGAGACCATATATCTCGAGATATATGGTCTCTCCGCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-1904s21c1
Sequence:CCGGTCCAAGCCGCAGCAGATTAAACTCGAGTTTAATCTGCTGCGGCTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-2970s21c1
Sequence:CCGGCTTGGAGACAATCCTGCGTTTCTCGAGAAACGCAGGATTGTCTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-1046s21c1
Sequence:CCGGGCACTCAATGTACCTGTCTTTCTCGAGAAAGACAGGTACATTGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004286
VALIDATED
GTPBP1 MISSION shRNA Lentiviral Transduction Particles
GTP binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004286.3-2808s1c1
Sequence:CCGGCTTGGAGACAATCCTGCGTTTCTCGAGAAACGCAGGATTGTCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004286.3-884s1c1
Sequence:CCGGGCACTCAATGTACCTGTCTTTCTCGAGAAAGACAGGTACATTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004286.3-1015s1c1
Sequence:CCGGGCAGAGCAAAGATGATGTGATCTCGAGATCACATCATCTTTGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004286.3-362s1c1
Sequence:CCGGGCGGAACAGATAGAGGCCGATCTCGAGATCGGCCTCTATCTGTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004286.3-1291s1c1
Sequence:CCGGCTTGGGTAACTTCCTGTCCATCTCGAGATGGACAGGAAGTTACCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-419s21c1
Sequence:CCGGGGATGCGGAGAGACCATATATCTCGAGATATATGGTCTCTCCGCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-1904s21c1
Sequence:CCGGTCCAAGCCGCAGCAGATTAAACTCGAGTTTAATCTGCTGCGGCTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286314    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-2970s21c1
Sequence:CCGGCTTGGAGACAATCCTGCGTTTCTCGAGAAACGCAGGATTGTCTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004286.4-1046s21c1
Sequence:CCGGGCACTCAATGTACCTGTCTTTCTCGAGAAAGACAGGTACATTGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013818
VALIDATED
GTPBP1 MISSION shRNA Bacterial Glycerol Stock
GTP binding protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013818.1-790s1c1
Sequence:CCGGGCACTCAATGTACCTGTGTTTCTCGAGAAACACAGGTACATTGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013818.1-558s1c1
Sequence:CCGGCGAAGGCAATGTAGTGAACAACTCGAGTTGTTCACTACATTGCCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013818.1-331s1c1
Sequence:CCGGCGTGATTACCTAGTCAGGAAACTCGAGTTTCCTGACTAGGTAATCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-2246s21c1
Sequence:CCGGTCGTACATCTGGGCCCTTAATCTCGAGATTAAGGGCCCAGATGTACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-773s21c1
Sequence:CCGGTGGCCACGAGAAGTACCTTAACTCGAGTTAAGGTACTTCTCGTGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013818.2-1563s21c1
Sequence:CCGGATCCGGCAAACAGCTACAATTCTCGAGAATTGTAGCTGTTTGCCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-1079s21c1
Sequence:CCGGTGAGAGGATGTGCCCGATATTCTCGAGAATATCGGGCACATCCTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-276s21c1
Sequence:CCGGGGATGCGGAGAGACCATATATCTCGAGATATATGGTCTCTCCGCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013818
VALIDATED
GTPBP1 MISSION shRNA shRNA Plasmid DNA
GTP binding protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013818.1-790s1c1
Sequence:CCGGGCACTCAATGTACCTGTGTTTCTCGAGAAACACAGGTACATTGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013818.1-558s1c1
Sequence:CCGGCGAAGGCAATGTAGTGAACAACTCGAGTTGTTCACTACATTGCCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013818.1-331s1c1
Sequence:CCGGCGTGATTACCTAGTCAGGAAACTCGAGTTTCCTGACTAGGTAATCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-2246s21c1
Sequence:CCGGTCGTACATCTGGGCCCTTAATCTCGAGATTAAGGGCCCAGATGTACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-773s21c1
Sequence:CCGGTGGCCACGAGAAGTACCTTAACTCGAGTTAAGGTACTTCTCGTGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013818.2-1563s21c1
Sequence:CCGGATCCGGCAAACAGCTACAATTCTCGAGAATTGTAGCTGTTTGCCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-1079s21c1
Sequence:CCGGTGAGAGGATGTGCCCGATATTCTCGAGAATATCGGGCACATCCTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-276s21c1
Sequence:CCGGGGATGCGGAGAGACCATATATCTCGAGATATATGGTCTCTCCGCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013818
VALIDATED
GTPBP1 MISSION shRNA Lentiviral Transduction Particles
GTP binding protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013818.1-790s1c1
Sequence:CCGGGCACTCAATGTACCTGTGTTTCTCGAGAAACACAGGTACATTGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013818.1-558s1c1
Sequence:CCGGCGAAGGCAATGTAGTGAACAACTCGAGTTGTTCACTACATTGCCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013818.1-331s1c1
Sequence:CCGGCGTGATTACCTAGTCAGGAAACTCGAGTTTCCTGACTAGGTAATCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-2246s21c1
Sequence:CCGGTCGTACATCTGGGCCCTTAATCTCGAGATTAAGGGCCCAGATGTACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-773s21c1
Sequence:CCGGTGGCCACGAGAAGTACCTTAACTCGAGTTAAGGTACTTCTCGTGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013818.2-1563s21c1
Sequence:CCGGATCCGGCAAACAGCTACAATTCTCGAGAATTGTAGCTGTTTGCCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-1079s21c1
Sequence:CCGGTGAGAGGATGTGCCCGATATTCTCGAGAATATCGGGCACATCCTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_013818.2-276s21c1
Sequence:CCGGGGATGCGGAGAGACCATATATCTCGAGATATATGGTCTCTCCGCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)