EMAIL THIS PAGE TO A FRIEND

GTPBP2

GTP binding protein 2

60 Gene Product Result for
Gene ID:
Human(54676) Summary: GTP-binding proteins, or G proteins, constitute a superfamily capable of binding GTP or GDP. G proteins are activated by binding GTP and are inactivated by hydrolyzing GTP to GDP. This general mechanism enables G proteins to perform a wide range of biologic activities.[supplied by OMIM, Jan 2003]
Mouse(56055) GTP binding protein 2
Rat(363195) GTP binding protein 2
Zebrafish(570143) GTP binding protein 2
dog(481818) GTP binding protein 2
chicken(421449) GTP binding protein 2
cow(513605) GTP binding protein 2
Horse(100067543) GTP binding protein 2
domestic cat(101088930) GTP binding protein 2
domestic guinea pig(100732124) GTP binding protein 2
naked mole-rat(101707695) GTP binding protein 2
Goat(100861265) GTP binding protein 2
sheep(101115579) GTP binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019581 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019581 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019581 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019096 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019096 Rosetta Predictions human pricing
NM_001013225 Rosetta Predictions rat pricing
NM_019581 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219382 predicted 1863
2 SASI_Hs01_00219383 predicted 669
3 SASI_Hs01_00219384 predicted 491
4 SASI_Hs01_00219385 predicted 1699
5 SASI_Hs01_00219387 predicted 448
6 SASI_Hs01_00219388 predicted 582
7 SASI_Hs01_00219389 predicted 1877
8 SASI_Hs01_00219390 predicted 986
9 SASI_Hs01_00219391 predicted 717
10 SASI_Hs02_00352712 predicted 1620
11 SASI_Hs01_00219386 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201028 predicted 739
2 SASI_Rn02_00201029 predicted 287
3 SASI_Rn02_00201030 predicted 1770
4 SASI_Rn02_00201031 predicted 1625
5 SASI_Rn02_00201032 predicted 1673
6 SASI_Rn02_00201033 predicted 1025
7 SASI_Rn02_00201034 predicted 565
8 SASI_Rn02_00201035 predicted 1261
9 SASI_Rn02_00201036 predicted 1440
10 SASI_Rn02_00201037 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164695 predicted 1887
2 SASI_Mm01_00164696 predicted 253
3 SASI_Mm01_00164697 predicted 701
4 SASI_Mm02_00324644 predicted 1400
5 SASI_Mm01_00164698 predicted 753
6 SASI_Mm01_00164699 predicted 1024
7 SASI_Mm01_00164700 predicted 310
8 SASI_Mm01_00164701 predicted 562
9 SASI_Mm01_00164702 predicted 1901
10 SASI_Mm01_00164703 predicted 1663
11 SASI_Mm01_00164704 predicted 807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019581
VALIDATED
GTPBP2 MISSION shRNA Bacterial Glycerol Stock
GTP binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019581.2-260s21c1
Sequence:CCGGGAAGATGGAAACATCGAATATCTCGAGATATTCGATGTTTCCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019581.2-207s21c1
Sequence:CCGGGAAGGAACAGAGGAGGTAAAGCTCGAGCTTTACCTCCTCTGTTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019581.2-2403s21c1
Sequence:CCGGGGTTGAGTCCCGATGCATATTCTCGAGAATATGCATCGGGACTCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019581.2-1654s21c1
Sequence:CCGGTGTGGGCAACGTACGTCAAACCTCGAGGTTTGACGTACGTTGCCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019581.2-1208s21c1
Sequence:CCGGGAGAGCCTGGACCTTCTTAAACTCGAGTTTAAGAAGGTCCAGGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019581
VALIDATED
GTPBP2 MISSION shRNA shRNA Plasmid DNA
GTP binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019581.2-260s21c1
Sequence:CCGGGAAGATGGAAACATCGAATATCTCGAGATATTCGATGTTTCCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019581.2-207s21c1
Sequence:CCGGGAAGGAACAGAGGAGGTAAAGCTCGAGCTTTACCTCCTCTGTTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019581.2-2403s21c1
Sequence:CCGGGGTTGAGTCCCGATGCATATTCTCGAGAATATGCATCGGGACTCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019581.2-1654s21c1
Sequence:CCGGTGTGGGCAACGTACGTCAAACCTCGAGGTTTGACGTACGTTGCCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019581.2-1208s21c1
Sequence:CCGGGAGAGCCTGGACCTTCTTAAACTCGAGTTTAAGAAGGTCCAGGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019581
VALIDATED
GTPBP2 MISSION shRNA Lentiviral Transduction Particles
GTP binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019581.2-260s21c1
Sequence:CCGGGAAGATGGAAACATCGAATATCTCGAGATATTCGATGTTTCCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019581.2-207s21c1
Sequence:CCGGGAAGGAACAGAGGAGGTAAAGCTCGAGCTTTACCTCCTCTGTTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019581.2-2403s21c1
Sequence:CCGGGGTTGAGTCCCGATGCATATTCTCGAGAATATGCATCGGGACTCAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_019581.2-1654s21c1
Sequence:CCGGTGTGGGCAACGTACGTCAAACCTCGAGGTTTGACGTACGTTGCCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019581.2-1208s21c1
Sequence:CCGGGAGAGCCTGGACCTTCTTAAACTCGAGTTTAAGAAGGTCCAGGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019096
GTPBP2 MISSION shRNA Bacterial Glycerol Stock
GTP binding protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-464s1c1
Sequence:CCGGGAGCGAGAAGTGGATTATGATCTCGAGATCATAATCCACTTCTCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019096.3-2258s1c1
Sequence:CCGGCCTCTTCTCAAGGCCATGTAACTCGAGTTACATGGCCTTGAGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-1522s1c1
Sequence:CCGGCCCGGAGATGAATCCTACCATCTCGAGATGGTAGGATTCATCTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-256s1c1
Sequence:CCGGGCTGGTGAATCCATCCCAGTACTCGAGTACTGGGATGGATTCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-1308s1c1
Sequence:CCGGCTGTTGTTGGAGGAACACTTTCTCGAGAAAGTGTTCCTCCAACAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019096
GTPBP2 MISSION shRNA shRNA Plasmid DNA
GTP binding protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-464s1c1
Sequence:CCGGGAGCGAGAAGTGGATTATGATCTCGAGATCATAATCCACTTCTCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019096.3-2258s1c1
Sequence:CCGGCCTCTTCTCAAGGCCATGTAACTCGAGTTACATGGCCTTGAGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-1522s1c1
Sequence:CCGGCCCGGAGATGAATCCTACCATCTCGAGATGGTAGGATTCATCTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-256s1c1
Sequence:CCGGGCTGGTGAATCCATCCCAGTACTCGAGTACTGGGATGGATTCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-1308s1c1
Sequence:CCGGCTGTTGTTGGAGGAACACTTTCTCGAGAAAGTGTTCCTCCAACAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019096
GTPBP2 MISSION shRNA Lentiviral Transduction Particles
GTP binding protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-464s1c1
Sequence:CCGGGAGCGAGAAGTGGATTATGATCTCGAGATCATAATCCACTTCTCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019096.3-2258s1c1
Sequence:CCGGCCTCTTCTCAAGGCCATGTAACTCGAGTTACATGGCCTTGAGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-1522s1c1
Sequence:CCGGCCCGGAGATGAATCCTACCATCTCGAGATGGTAGGATTCATCTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-256s1c1
Sequence:CCGGGCTGGTGAATCCATCCCAGTACTCGAGTACTGGGATGGATTCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019096.3-1308s1c1
Sequence:CCGGCTGTTGTTGGAGGAACACTTTCTCGAGAAAGTGTTCCTCCAACAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)