EMAIL THIS PAGE TO A FRIEND

GTPBP3

GTP binding protein 3 (mitochondrial)

129 Gene Product Result for
Synonyms: GTPBG3 MSS1 MTGP1 THDF1
Gene ID:
Human(84705) Summary: This locus encodes a GTP-binding protein. The encoded protein is localized to the mitochondria and may play a role in mitochondrial tRNA modification. Polymorphisms at this locus may be associated with severity of aminoglycoside-induced deafness, a disease associated with a mutation in the 12S rRNA. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2010]
Mouse(70359) GTP binding protein 3
Rat(290633) GTP binding protein 3
sheep(101112132) GTP binding protein 3 (mitochondrial)
domestic guinea pig(100733294) GTP binding protein 3 (mitochondrial)
naked mole-rat(101718127) GTP binding protein 3 (mitochondrial)
Zebrafish(553807) GTP binding protein 3
dog(484838) GTP binding protein 3 (mitochondrial)
domestic cat(101097049) GTP binding protein 3 (mitochondrial)
cow(539656) GTP binding protein 3 (mitochondrial)
Horse(100070158) GTP binding protein 3 (mitochondrial)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032544 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032544 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032544 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032620 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032620 Rosetta Predictions human pricing
NM_133644 Rosetta Predictions human pricing
NM_001011919 Rosetta Predictions rat pricing
XM_577500 Rosetta Predictions rat pricing
NM_032544 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189698 predicted 1575
2 SASI_Hs01_00189699 predicted 1375
3 SASI_Hs01_00189700 predicted 920
4 SASI_Hs01_00189701 predicted 1534
5 SASI_Hs01_00189703 predicted 1586
6 SASI_Hs01_00189704 predicted 911
7 SASI_Hs01_00189705 predicted 1614
8 SASI_Hs01_00189706 predicted 1572
9 SASI_Hs01_00189707 predicted 921
10 SASI_Hs02_00360171 predicted 1534
11 SASI_Hs01_00189702 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214987 predicted 1689
2 SASI_Hs01_00214988 predicted 1488
3 SASI_Hs01_00214989 predicted 1033
4 SASI_Hs01_00214990 predicted 1648
5 SASI_Hs01_00214992 predicted 1701
6 SASI_Hs01_00214993 predicted 1020
7 SASI_Hs01_00214994 predicted 1685
8 SASI_Hs01_00214995 predicted 1027
9 SASI_Hs02_00363284 predicted 1651
10 SASI_Hs02_00363285 predicted 1036
11 SASI_Hs01_00214991 predicted 1607
12 SASI_Hs01_00214996 predicted 1638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011919 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030202 predicted 1880
2 SASI_Rn01_00030203 predicted 1530
3 SASI_Rn01_00030204 predicted 634
4 SASI_Rn01_00030205 predicted 1670
5 SASI_Rn01_00030206 predicted 649
6 SASI_Rn01_00030207 predicted 653
7 SASI_Rn01_00030208 predicted 467
8 SASI_Rn02_00199917 predicted 1716
9 SASI_Rn02_00199918 predicted 322
10 SASI_Rn01_00030201 predicted 936
11 SASI_Rn01_00030209 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158629 predicted 1002
2 SASI_Rn01_00158630 predicted 740
3 SASI_Rn01_00158631 predicted 706
4 SASI_Rn01_00158632 predicted 718
5 SASI_Rn01_00158633 predicted 735
6 SASI_Rn01_00158634 predicted 551
7 SASI_Rn01_00158635 predicted 402
8 SASI_Rn01_00158636 predicted 571
9 SASI_Rn01_00158637 predicted 748
10 SASI_Rn01_00158638 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337256 predicted 990
2 SASI_Mm02_00337257 predicted 1804
3 SASI_Mm02_00337258 predicted 1162
4 SASI_Mm02_00337259 predicted 2125
5 SASI_Mm02_00337260 predicted 1288
6 SASI_Mm02_00337261 predicted 2323
7 SASI_Mm02_00337262 predicted 1327
8 SASI_Mm02_00337263 predicted 2077
9 SASI_Mm02_00337264 predicted 1478
10 SASI_Mm02_00337265 predicted 2205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032544
VALIDATED
GTPBP3 MISSION shRNA Bacterial Glycerol Stock
GTP binding protein 3 (mitochondrial)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-2629s1c1
Sequence:CCGGGCTTCTATTTATGGCATCGTTCTCGAGAACGATGCCATAAATAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032544.2-1169s1c1
Sequence:CCGGGCAGATCTTATCCGTGCAGAACTCGAGTTCTGCACGGATAAGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-1479s1c1
Sequence:CCGGTGGTGAATCTACTCAGCCAAACTCGAGTTTGGCTGAGTAGATTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-1304s1c1
Sequence:CCGGGACTTCGGAGAGGATGATAATCTCGAGATTATCATCCTCTCCGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032544.3-2072s21c1
Sequence:CCGGCAGGCTCGGAGGCAACTAAATCTCGAGATTTAGTTGCCTCCGAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-1304s21c1
Sequence:CCGGGACTTCGGAGAGGATGATAATCTCGAGATTATCATCCTCTCCGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-1796s1c1
Sequence:CCGGCTGCTGCTCAACAAATCTGATCTCGAGATCAGATTTGTTGAGCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-1479s21c1
Sequence:CCGGTGGTGAATCTACTCAGCCAAACTCGAGTTTGGCTGAGTAGATTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-1796s21c1
Sequence:CCGGCTGCTGCTCAACAAATCTGATCTCGAGATCAGATTTGTTGAGCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-2383s21c1
Sequence:CCGGGAAACCCGTTGCATGTTATATCTCGAGATATAACATGCAACGGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032544
VALIDATED
GTPBP3 MISSION shRNA shRNA Plasmid DNA
GTP binding protein 3 (mitochondrial)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-2629s1c1
Sequence:CCGGGCTTCTATTTATGGCATCGTTCTCGAGAACGATGCCATAAATAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032544.2-1169s1c1
Sequence:CCGGGCAGATCTTATCCGTGCAGAACTCGAGTTCTGCACGGATAAGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-1479s1c1
Sequence:CCGGTGGTGAATCTACTCAGCCAAACTCGAGTTTGGCTGAGTAGATTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-1304s1c1
Sequence:CCGGGACTTCGGAGAGGATGATAATCTCGAGATTATCATCCTCTCCGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032544.3-2072s21c1
Sequence:CCGGCAGGCTCGGAGGCAACTAAATCTCGAGATTTAGTTGCCTCCGAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-1304s21c1
Sequence:CCGGGACTTCGGAGAGGATGATAATCTCGAGATTATCATCCTCTCCGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-1796s1c1
Sequence:CCGGCTGCTGCTCAACAAATCTGATCTCGAGATCAGATTTGTTGAGCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-1479s21c1
Sequence:CCGGTGGTGAATCTACTCAGCCAAACTCGAGTTTGGCTGAGTAGATTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-1796s21c1
Sequence:CCGGCTGCTGCTCAACAAATCTGATCTCGAGATCAGATTTGTTGAGCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-2383s21c1
Sequence:CCGGGAAACCCGTTGCATGTTATATCTCGAGATATAACATGCAACGGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032544
VALIDATED
GTPBP3 MISSION shRNA Lentiviral Transduction Particles
GTP binding protein 3 (mitochondrial)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102665    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-2629s1c1
Sequence:CCGGGCTTCTATTTATGGCATCGTTCTCGAGAACGATGCCATAAATAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032544.2-1169s1c1
Sequence:CCGGGCAGATCTTATCCGTGCAGAACTCGAGTTCTGCACGGATAAGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-1479s1c1
Sequence:CCGGTGGTGAATCTACTCAGCCAAACTCGAGTTTGGCTGAGTAGATTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-1304s1c1
Sequence:CCGGGACTTCGGAGAGGATGATAATCTCGAGATTATCATCCTCTCCGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032544.3-2072s21c1
Sequence:CCGGCAGGCTCGGAGGCAACTAAATCTCGAGATTTAGTTGCCTCCGAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-1304s21c1
Sequence:CCGGGACTTCGGAGAGGATGATAATCTCGAGATTATCATCCTCTCCGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_032544.2-1796s1c1
Sequence:CCGGCTGCTGCTCAACAAATCTGATCTCGAGATCAGATTTGTTGAGCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-1479s21c1
Sequence:CCGGTGGTGAATCTACTCAGCCAAACTCGAGTTTGGCTGAGTAGATTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-1796s21c1
Sequence:CCGGCTGCTGCTCAACAAATCTGATCTCGAGATCAGATTTGTTGAGCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295714    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_032544.3-2383s21c1
Sequence:CCGGGAAACCCGTTGCATGTTATATCTCGAGATATAACATGCAACGGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032620
VALIDATED
GTPBP3 MISSION shRNA Bacterial Glycerol Stock
GTP binding protein 3 (mitochondrial)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-723s21c1
Sequence:CCGGGAGCAAGCCGACATCGAAGTACTCGAGTACTTCGATGTCGGCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-855s21c1
Sequence:CCGGAGCCTAGTGAACCTGCTCAGTCTCGAGACTGAGCAGGTTCACTAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-506s21c1
Sequence:CCGGGTTCGCCAATGGGAAGCTGAACTCGAGTTCAGCTTCCCATTGGCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-140s1c1
Sequence:CCGGGCGCCACCATCTTCGCGCTAACTCGAGTTAGCGCGAAGATGGTGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-373s21c1
Sequence:CCGGAGAGTTTCACCGGTGAGGACTCTCGAGAGTCCTCACCGGTGAAACTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-1158s1c1
Sequence:CCGGGCTGAACAAGTCGGACCTGCTCTCGAGAGCAGGTCCGACTTGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-1377s1c1
Sequence:CCGGCGGCCACTACAAGCAGTCAAACTCGAGTTTGACTGCTTGTAGTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032620.1-645s1c1
Sequence:CCGGCGTGGAGGCCTATATCGATTTCTCGAGAAATCGATATAGGCCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-527s1c1
Sequence:CCGGCGGACCTTATCCACGCGGAAACTCGAGTTTCCGCGTGGATAAGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-1091s21c1
Sequence:CCGGCTCTCCCTCCAGTTGCAACTTCTCGAGAAGTTGCAACTGGAGGGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-1522s21c1
Sequence:CCGGAGGACTTCTGTGTGGGCAAGTCTCGAGACTTGCCCACACAGAAGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-734s21c1
Sequence:CCGGCATCGAAGTACGGGCACTGCACTCGAGTGCAGTGCCCGTACTTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-877s21c1
Sequence:CCGGGGAAGCCTGTGTCCATCGTGTCTCGAGACACGATGGACACAGGCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-520s21c1
Sequence:CCGGAGCTGAACCTGACCGAAGTGGCTCGAGCCACTTCGGTCAGGTTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-679s21c1
Sequence:CCGGATATCGATTTCGGCGAGGATGCTCGAGCATCCTCGCCGAAATCGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032620
VALIDATED
GTPBP3 MISSION shRNA shRNA Plasmid DNA
GTP binding protein 3 (mitochondrial)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-723s21c1
Sequence:CCGGGAGCAAGCCGACATCGAAGTACTCGAGTACTTCGATGTCGGCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-855s21c1
Sequence:CCGGAGCCTAGTGAACCTGCTCAGTCTCGAGACTGAGCAGGTTCACTAGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-506s21c1
Sequence:CCGGGTTCGCCAATGGGAAGCTGAACTCGAGTTCAGCTTCCCATTGGCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-140s1c1
Sequence:CCGGGCGCCACCATCTTCGCGCTAACTCGAGTTAGCGCGAAGATGGTGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-373s21c1
Sequence:CCGGAGAGTTTCACCGGTGAGGACTCTCGAGAGTCCTCACCGGTGAAACTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-1158s1c1
Sequence:CCGGGCTGAACAAGTCGGACCTGCTCTCGAGAGCAGGTCCGACTTGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-1377s1c1
Sequence:CCGGCGGCCACTACAAGCAGTCAAACTCGAGTTTGACTGCTTGTAGTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032620.1-645s1c1
Sequence:CCGGCGTGGAGGCCTATATCGATTTCTCGAGAAATCGATATAGGCCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-527s1c1
Sequence:CCGGCGGACCTTATCCACGCGGAAACTCGAGTTTCCGCGTGGATAAGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-1091s21c1
Sequence:CCGGCTCTCCCTCCAGTTGCAACTTCTCGAGAAGTTGCAACTGGAGGGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-1522s21c1
Sequence:CCGGAGGACTTCTGTGTGGGCAAGTCTCGAGACTTGCCCACACAGAAGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-734s21c1
Sequence:CCGGCATCGAAGTACGGGCACTGCACTCGAGTGCAGTGCCCGTACTTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-877s21c1
Sequence:CCGGGGAAGCCTGTGTCCATCGTGTCTCGAGACACGATGGACACAGGCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-520s21c1
Sequence:CCGGAGCTGAACCTGACCGAAGTGGCTCGAGCCACTTCGGTCAGGTTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-679s21c1
Sequence:CCGGATATCGATTTCGGCGAGGATGCTCGAGCATCCTCGCCGAAATCGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032620
VALIDATED
GTPBP3 MISSION shRNA Lentiviral Transduction Particles
GTP binding protein 3 (mitochondrial)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-723s21c1
Sequence:CCGGGAGCAAGCCGACATCGAAGTACTCGAGTACTTCGATGTCGGCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-855s21c1
Sequence:CCGGAGCCTAGTGAACCTGCTCAGTCTCGAGACTGAGCAGGTTCACTAGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-506s21c1
Sequence:CCGGGTTCGCCAATGGGAAGCTGAACTCGAGTTCAGCTTCCCATTGGCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-140s1c1
Sequence:CCGGGCGCCACCATCTTCGCGCTAACTCGAGTTAGCGCGAAGATGGTGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-373s21c1
Sequence:CCGGAGAGTTTCACCGGTGAGGACTCTCGAGAGTCCTCACCGGTGAAACTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-1158s1c1
Sequence:CCGGGCTGAACAAGTCGGACCTGCTCTCGAGAGCAGGTCCGACTTGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-1377s1c1
Sequence:CCGGCGGCCACTACAAGCAGTCAAACTCGAGTTTGACTGCTTGTAGTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032620.1-645s1c1
Sequence:CCGGCGTGGAGGCCTATATCGATTTCTCGAGAAATCGATATAGGCCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032620.1-527s1c1
Sequence:CCGGCGGACCTTATCCACGCGGAAACTCGAGTTTCCGCGTGGATAAGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-1091s21c1
Sequence:CCGGCTCTCCCTCCAGTTGCAACTTCTCGAGAAGTTGCAACTGGAGGGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-1522s21c1
Sequence:CCGGAGGACTTCTGTGTGGGCAAGTCTCGAGACTTGCCCACACAGAAGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-734s21c1
Sequence:CCGGCATCGAAGTACGGGCACTGCACTCGAGTGCAGTGCCCGTACTTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-877s21c1
Sequence:CCGGGGAAGCCTGTGTCCATCGTGTCTCGAGACACGATGGACACAGGCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-520s21c1
Sequence:CCGGAGCTGAACCTGACCGAAGTGGCTCGAGCCACTTCGGTCAGGTTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032620.2-679s21c1
Sequence:CCGGATATCGATTTCGGCGAGGATGCTCGAGCATCCTCGCCGAAATCGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)