EMAIL THIS PAGE TO A FRIEND

GTPBP4

GTP binding protein 4

79 Gene Product Result for
Synonyms: CRFG NGB NOG1
UniProtKB ID: Q9BZE4, B3KMC5, O95446, Q5T3R8, Q9NVJ8
Gene ID:
Human(23560) Summary: GTP-binding proteins are GTPases and function as molecular switches that can flip between two states: active, when GTP is bound, and inactive, when GDP is bound. 'Active' in this context usually means that the molecule acts as a signal to trigger other events in the cell. When an extracellular ligand binds to a G-protein-linked receptor, the receptor changes its conformation and switches on the trimeric G proteins that associate with it by causing them to eject their GDP and replace it with GTP. The switch is turned off when the G protein hydrolyzes its own bound GTP, converting it back to GDP. But before that occurs, the active protein has an opportunity to diffuse away from the receptor and deliver its message for a prolonged period to its downstream target. [provided by RefSeq, Jul 2008]
Mouse(69237) GTP binding protein 4
Rat(114300) GTP binding protein 4
Zebrafish(334050) GTP binding protein 4
chicken(420458) GTP binding protein 4
dog(478021) GTP binding protein 4
cow(524743) GTP binding protein 4
Horse(100071237) GTP binding protein 4
domestic cat(101094514) GTP binding protein 4
domestic guinea pig(100721906) GTP binding protein 4
naked mole-rat(101713369) GTP binding protein 4
sheep(101112499) GTP binding protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027000 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027000 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027000 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012341 Rosetta Predictions human pricing
NM_053689 Rosetta Predictions rat pricing
XM_001065751 Rosetta Predictions rat pricing
XM_214503 Rosetta Predictions rat pricing
NM_027000 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153882 predicted 274
2 SASI_Hs01_00153883 predicted 1960
3 SASI_Hs01_00153884 predicted 413
4 SASI_Hs01_00153885 predicted 297
5 SASI_Hs01_00153887 predicted 1272
6 SASI_Hs02_00344141 predicted 1117
7 SASI_Hs01_00153888 predicted 701
8 SASI_Hs02_00344142 predicted 684
9 SASI_Hs02_00344143 predicted 1352
10 SASI_Hs01_00153889 predicted 1125
11 SASI_Hs01_00153881 predicted 956
12 SASI_Hs01_00153886 predicted 1373
13 SASI_Hs01_00153890 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043564 predicted 269
2 SASI_Rn01_00043565 predicted 853
3 SASI_Rn01_00043566 predicted 462
4 SASI_Rn01_00043567 predicted 612
5 SASI_Rn01_00043568 predicted 490
6 SASI_Rn02_00266443 predicted 818
7 SASI_Rn02_00266444 predicted 1087
8 SASI_Rn02_00266445 predicted 831
9 SASI_Rn02_00266446 predicted 1041
10 SASI_Rn01_00043571 predicted 287
11 SASI_Rn01_00043569 predicted 322
12 SASI_Rn01_00043570 predicted 560
13 SASI_Rn01_00043572 predicted 88
14 SASI_Rn01_00043573 predicted 1780
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315256 predicted 211
2 SASI_Rn02_00315257 predicted 199
3 SASI_Rn02_00315258 predicted 200
4 SASI_Rn02_00315259 predicted 208
5 SASI_Rn02_00315260 predicted 210
6 SASI_Rn02_00315261 predicted 199
7 SASI_Rn02_00315262 predicted 417
8 SASI_Rn02_00315263 predicted 86
9 SASI_Rn02_00315264 predicted 399
10 SASI_Rn02_00315265 predicted 175
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150043 predicted 323
2 SASI_Rn01_00150044 predicted 324
3 SASI_Rn01_00150045 predicted 569
4 SASI_Rn01_00150046 predicted 312
5 SASI_Rn01_00150047 predicted 567
6 SASI_Rn01_00150048 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192859 predicted 895
2 SASI_Mm01_00192860 predicted 291
3 SASI_Mm01_00192861 predicted 221
4 SASI_Mm02_00331358 predicted 1065
5 SASI_Mm02_00331359 predicted 1620
6 SASI_Mm01_00192863 predicted 852
7 SASI_Mm01_00192864 predicted 359
8 SASI_Mm01_00192865 predicted 609
9 SASI_Mm01_00192866 predicted 305
10 SASI_Mm01_00192867 predicted 1147
11 SASI_Mm01_00192858 predicted 264
12 SASI_Mm01_00192862 predicted 845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012341
VALIDATED
GTPBP4 MISSION shRNA Bacterial Glycerol Stock
GTP binding protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-2325s21c1
Sequence:CCGGTGTCGGAATCCCGTGCTTAAACTCGAGTTTAAGCACGGGATTCCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012341.2-533s21c1
Sequence:CCGGGCGTCAGCATTTATCCCGTTTCTCGAGAAACGGGATAAATGCTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-1092s21c1
Sequence:CCGGGCTCATCGAGTGGAAACCAAACTCGAGTTTGGTTTCCACTCGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-1458s21c1
Sequence:CCGGGCTGGAGAGTATGACAGTGTACTCGAGTACACTGTCATACTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-485s1c1
Sequence:CCGGGCGTCAGCATTTATCCCGTTTCTCGAGAAACGGGATAAATGCTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-1044s1c1
Sequence:CCGGGCTCATCGAGTGGAAACCAAACTCGAGTTTGGTTTCCACTCGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-1410s1c1
Sequence:CCGGGCTGGAGAGTATGACAGTGTACTCGAGTACACTGTCATACTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-1595s1c1
Sequence:CCGGGCGTAGTCTTGGTGTTGACATCTCGAGATGTCAACACCAAGACTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-114s1c1
Sequence:CCGGCCAACCGTTATTCATAAACATCTCGAGATGTTTATGAATAACGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-1643s21c1
Sequence:CCGGGCGTAGTCTTGGTGTTGACATCTCGAGATGTCAACACCAAGACTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012341
VALIDATED
GTPBP4 MISSION shRNA shRNA Plasmid DNA
GTP binding protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-2325s21c1
Sequence:CCGGTGTCGGAATCCCGTGCTTAAACTCGAGTTTAAGCACGGGATTCCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012341.2-533s21c1
Sequence:CCGGGCGTCAGCATTTATCCCGTTTCTCGAGAAACGGGATAAATGCTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-1092s21c1
Sequence:CCGGGCTCATCGAGTGGAAACCAAACTCGAGTTTGGTTTCCACTCGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-1458s21c1
Sequence:CCGGGCTGGAGAGTATGACAGTGTACTCGAGTACACTGTCATACTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-485s1c1
Sequence:CCGGGCGTCAGCATTTATCCCGTTTCTCGAGAAACGGGATAAATGCTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-1044s1c1
Sequence:CCGGGCTCATCGAGTGGAAACCAAACTCGAGTTTGGTTTCCACTCGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-1410s1c1
Sequence:CCGGGCTGGAGAGTATGACAGTGTACTCGAGTACACTGTCATACTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-1595s1c1
Sequence:CCGGGCGTAGTCTTGGTGTTGACATCTCGAGATGTCAACACCAAGACTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-114s1c1
Sequence:CCGGCCAACCGTTATTCATAAACATCTCGAGATGTTTATGAATAACGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-1643s21c1
Sequence:CCGGGCGTAGTCTTGGTGTTGACATCTCGAGATGTCAACACCAAGACTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012341
VALIDATED
GTPBP4 MISSION shRNA Lentiviral Transduction Particles
GTP binding protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-2325s21c1
Sequence:CCGGTGTCGGAATCCCGTGCTTAAACTCGAGTTTAAGCACGGGATTCCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012341.2-533s21c1
Sequence:CCGGGCGTCAGCATTTATCCCGTTTCTCGAGAAACGGGATAAATGCTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-1092s21c1
Sequence:CCGGGCTCATCGAGTGGAAACCAAACTCGAGTTTGGTTTCCACTCGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-1458s21c1
Sequence:CCGGGCTGGAGAGTATGACAGTGTACTCGAGTACACTGTCATACTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-485s1c1
Sequence:CCGGGCGTCAGCATTTATCCCGTTTCTCGAGAAACGGGATAAATGCTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-1044s1c1
Sequence:CCGGGCTCATCGAGTGGAAACCAAACTCGAGTTTGGTTTCCACTCGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-1410s1c1
Sequence:CCGGGCTGGAGAGTATGACAGTGTACTCGAGTACACTGTCATACTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-1595s1c1
Sequence:CCGGGCGTAGTCTTGGTGTTGACATCTCGAGATGTCAACACCAAGACTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_012341.1-114s1c1
Sequence:CCGGCCAACCGTTATTCATAAACATCTCGAGATGTTTATGAATAACGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012341.2-1643s21c1
Sequence:CCGGGCGTAGTCTTGGTGTTGACATCTCGAGATGTCAACACCAAGACTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027000
VALIDATED
GTPBP4 MISSION shRNA Bacterial Glycerol Stock
GTP binding protein 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027000.2-364s1c1
Sequence:CCGGCGTCTTATGAAATATGGTGATCTCGAGATCACCATATTTCATAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027000.2-1582s1c1
Sequence:CCGGGAGAATGAGATGCGTAGTCTTCTCGAGAAGACTACGCATCTCATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-418s21c1
Sequence:CCGGTGGACGAATGTGTACTATTATCTCGAGATAATAGTACACATTCGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-634s21c1
Sequence:CCGGTGTTGGGCACATGGATTATAACTCGAGTTATAATCCATGTGCCCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027000.4-2320s1c1
Sequence:CCGGGAGCTTAAACTACTCTTAAATCTCGAGATTTAAGAGTAGTTTAAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-2230s21c1
Sequence:CCGGTGTCACCTAAAGTACCTATTTCTCGAGAAATAGGTACTTTAGGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-346s21c1
Sequence:CCGGTAAAGATTATGTGCGTCTTATCTCGAGATAAGACGCACATAATCTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-1320s21c1
Sequence:CCGGGCCACAATGTTGCTGATTATACTCGAGTATAATCAGCAACATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027000.2-517s1c1
Sequence:CCGGCCAAATACAAGGACTCTGCTTCTCGAGAAGCAGAGTCCTTGTATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027000
VALIDATED
GTPBP4 MISSION shRNA shRNA Plasmid DNA
GTP binding protein 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027000.2-364s1c1
Sequence:CCGGCGTCTTATGAAATATGGTGATCTCGAGATCACCATATTTCATAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027000.2-1582s1c1
Sequence:CCGGGAGAATGAGATGCGTAGTCTTCTCGAGAAGACTACGCATCTCATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-418s21c1
Sequence:CCGGTGGACGAATGTGTACTATTATCTCGAGATAATAGTACACATTCGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-634s21c1
Sequence:CCGGTGTTGGGCACATGGATTATAACTCGAGTTATAATCCATGTGCCCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027000.4-2320s1c1
Sequence:CCGGGAGCTTAAACTACTCTTAAATCTCGAGATTTAAGAGTAGTTTAAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-2230s21c1
Sequence:CCGGTGTCACCTAAAGTACCTATTTCTCGAGAAATAGGTACTTTAGGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-346s21c1
Sequence:CCGGTAAAGATTATGTGCGTCTTATCTCGAGATAAGACGCACATAATCTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-1320s21c1
Sequence:CCGGGCCACAATGTTGCTGATTATACTCGAGTATAATCAGCAACATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027000.2-517s1c1
Sequence:CCGGCCAAATACAAGGACTCTGCTTCTCGAGAAGCAGAGTCCTTGTATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027000
VALIDATED
GTPBP4 MISSION shRNA Lentiviral Transduction Particles
GTP binding protein 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027000.2-364s1c1
Sequence:CCGGCGTCTTATGAAATATGGTGATCTCGAGATCACCATATTTCATAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027000.2-1582s1c1
Sequence:CCGGGAGAATGAGATGCGTAGTCTTCTCGAGAAGACTACGCATCTCATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-418s21c1
Sequence:CCGGTGGACGAATGTGTACTATTATCTCGAGATAATAGTACACATTCGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-634s21c1
Sequence:CCGGTGTTGGGCACATGGATTATAACTCGAGTTATAATCCATGTGCCCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027000.4-2320s1c1
Sequence:CCGGGAGCTTAAACTACTCTTAAATCTCGAGATTTAAGAGTAGTTTAAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-2230s21c1
Sequence:CCGGTGTCACCTAAAGTACCTATTTCTCGAGAAATAGGTACTTTAGGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-346s21c1
Sequence:CCGGTAAAGATTATGTGCGTCTTATCTCGAGATAAGACGCACATAATCTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027000.4-1320s21c1
Sequence:CCGGGCCACAATGTTGCTGATTATACTCGAGTATAATCAGCAACATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027000.2-517s1c1
Sequence:CCGGCCAAATACAAGGACTCTGCTTCTCGAGAAGCAGAGTCCTTGTATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)