EMAIL THIS PAGE TO A FRIEND

GTPBP6

GTP binding protein 6 (putative)

54 Gene Product Result for
Synonyms: PGPL
UniProtKB ID: O43824, Q53F77, Q5HYX8
Gene ID:
Human(8225) Summary: This gene encodes a GTP binding protein and is located in the pseudoautosomal region (PAR) at the end of the short arms of the X and Y chromosomes. [provided by RefSeq, Nov 2011]
Mouse(107999) GTP binding protein 6 (putative)
Rat(363931) GTP binding protein 6 (putative)
Zebrafish(386823) GTP binding protein 6 (putative)
chicken(418672) GTP binding protein 6 (putative)
dog(608710) GTP binding protein 6 (putative)
cow(100298830) GTP binding protein 6 (putative)
domestic cat(101099690) GTP binding protein 6 (putative)
naked mole-rat(101726133) GTP binding protein 6 (putative)
sheep(101117061) GTP binding protein 6 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145147 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145147 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145147 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012227 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012227 Rosetta Predictions human pricing
XM_001078867 Rosetta Predictions rat pricing
XM_344118 Rosetta Predictions rat pricing
NM_145147 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343903 predicted 810
2 SASI_Hs01_00116591 predicted 503
3 SASI_Hs01_00116592 predicted 1490
4 SASI_Hs01_00116594 predicted 1502
5 SASI_Hs01_00116595 predicted 426
6 SASI_Hs01_00116596 predicted 396
7 SASI_Hs02_00343904 predicted 615
8 SASI_Hs02_00343905 predicted 902
9 SASI_Hs01_00116597 predicted 450
10 SASI_Hs02_00343906 predicted 1218
11 SASI_Hs01_00116590 predicted 459
12 SASI_Hs01_00116593 predicted 1593
13 SASI_Hs01_00116598 predicted 1478
14 SASI_Hs01_00116599 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362290 predicted 270
2 SASI_Rn02_00362291 predicted 553
3 SASI_Rn02_00362292 predicted 461
4 SASI_Rn02_00362293 predicted 640
5 SASI_Rn02_00362294 predicted 1246
6 SASI_Rn02_00362295 predicted 459
7 SASI_Rn02_00362296 predicted 899
8 SASI_Rn02_00362297 predicted 255
9 SASI_Rn02_00362298 predicted 1185
10 SASI_Rn02_00362299 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396816 predicted 267
2 SASI_Rn02_00396817 predicted 559
3 SASI_Rn02_00396818 predicted 463
4 SASI_Rn02_00396819 predicted 635
5 SASI_Rn02_00396820 predicted 1248
6 SASI_Rn02_00396821 predicted 461
7 SASI_Rn02_00396822 predicted 892
8 SASI_Rn02_00396823 predicted 259
9 SASI_Rn02_00396824 predicted 1188
10 SASI_Rn02_00396825 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340548 predicted 305
2 SASI_Mm01_00150975 predicted 1097
3 SASI_Mm02_00340549 predicted 589
4 SASI_Mm02_00340550 predicted 502
5 SASI_Mm01_00150976 predicted 970
6 SASI_Mm01_00150977 predicted 1226
7 SASI_Mm02_00340551 predicted 439
8 SASI_Mm01_00150978 predicted 1114
9 SASI_Mm01_00150979 predicted 1379
10 SASI_Mm02_00340552 predicted 492
11 SASI_Mm01_00150980 predicted 777
12 SASI_Mm01_00150981 predicted 803
13 SASI_Mm01_00150982 predicted 844
14 SASI_Mm01_00150983 predicted 913
15 SASI_Mm01_00150984 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145147
VALIDATED
GTPBP6 MISSION shRNA Bacterial Glycerol Stock
GTP binding protein 6 (putative)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145147.2-903s1c1
Sequence:CCGGGCATCTTGTACGTGGACACTACTCGAGTAGTGTCCACGTACAAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145147.2-844s1c1
Sequence:CCGGCCAACCGTTTGCTACTCTTGACTCGAGTCAAGAGTAGCAAACGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145147.2-774s1c1
Sequence:CCGGGATACACCAACTGTGGGAAGACTCGAGTCTTCCCACAGTTGGTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145147.2-904s1c1
Sequence:CCGGCATCTTGTACGTGGACACTATCTCGAGATAGTGTCCACGTACAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145147
VALIDATED
GTPBP6 MISSION shRNA shRNA Plasmid DNA
GTP binding protein 6 (putative)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145147.2-903s1c1
Sequence:CCGGGCATCTTGTACGTGGACACTACTCGAGTAGTGTCCACGTACAAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145147.2-844s1c1
Sequence:CCGGCCAACCGTTTGCTACTCTTGACTCGAGTCAAGAGTAGCAAACGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145147.2-774s1c1
Sequence:CCGGGATACACCAACTGTGGGAAGACTCGAGTCTTCCCACAGTTGGTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145147.2-904s1c1
Sequence:CCGGCATCTTGTACGTGGACACTATCTCGAGATAGTGTCCACGTACAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145147
VALIDATED
GTPBP6 MISSION shRNA Lentiviral Transduction Particles
GTP binding protein 6 (putative)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145147.2-903s1c1
Sequence:CCGGGCATCTTGTACGTGGACACTACTCGAGTAGTGTCCACGTACAAGATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000189564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145147.2-844s1c1
Sequence:CCGGCCAACCGTTTGCTACTCTTGACTCGAGTCAAGAGTAGCAAACGGTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145147.2-774s1c1
Sequence:CCGGGATACACCAACTGTGGGAAGACTCGAGTCTTCCCACAGTTGGTGTATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000201513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145147.2-904s1c1
Sequence:CCGGCATCTTGTACGTGGACACTATCTCGAGATAGTGTCCACGTACAAGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012227
VALIDATED
GTPBP6 MISSION shRNA Bacterial Glycerol Stock
GTP binding protein 6 (putative)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-602s1c1
Sequence:CCGGCCTGCACATCTTCCGCTGTAACTCGAGTTACAGCGGAAGATGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-540s1c1
Sequence:CCGGCCGACCAAGAAAGAACTGGAACTCGAGTTCCAGTTCTTTCTTGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-435s1c1
Sequence:CCGGAGGAAGCTCATCTTTGGCAAACTCGAGTTTGCCAAAGATGAGCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-1422s1c1
Sequence:CCGGCTGTATAAGGAGGCCACAGTTCTCGAGAACTGTGGCCTCCTTATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-671s21c1
Sequence:CCGGGCTGCACAGGTCGAACTTGAACTCGAGTTCAAGTTCGACCTGTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-577s21c1
Sequence:CCGGAGGTGTTTGACCGCTTCACGGCTCGAGCCGTGAAGCGGTCAAACACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-1117s21c1
Sequence:CCGGATCTCATCTTGCACGTGAGGGCTCGAGCCCTCACGTGCAAGATGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-1375s21c1
Sequence:CCGGAGATCCTCACTCTCCGTGTGACTCGAGTCACACGGAGAGTGAGGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012227
VALIDATED
GTPBP6 MISSION shRNA shRNA Plasmid DNA
GTP binding protein 6 (putative)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-602s1c1
Sequence:CCGGCCTGCACATCTTCCGCTGTAACTCGAGTTACAGCGGAAGATGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-540s1c1
Sequence:CCGGCCGACCAAGAAAGAACTGGAACTCGAGTTCCAGTTCTTTCTTGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-435s1c1
Sequence:CCGGAGGAAGCTCATCTTTGGCAAACTCGAGTTTGCCAAAGATGAGCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-1422s1c1
Sequence:CCGGCTGTATAAGGAGGCCACAGTTCTCGAGAACTGTGGCCTCCTTATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-671s21c1
Sequence:CCGGGCTGCACAGGTCGAACTTGAACTCGAGTTCAAGTTCGACCTGTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-577s21c1
Sequence:CCGGAGGTGTTTGACCGCTTCACGGCTCGAGCCGTGAAGCGGTCAAACACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-1117s21c1
Sequence:CCGGATCTCATCTTGCACGTGAGGGCTCGAGCCCTCACGTGCAAGATGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-1375s21c1
Sequence:CCGGAGATCCTCACTCTCCGTGTGACTCGAGTCACACGGAGAGTGAGGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012227
VALIDATED
GTPBP6 MISSION shRNA Lentiviral Transduction Particles
GTP binding protein 6 (putative)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-602s1c1
Sequence:CCGGCCTGCACATCTTCCGCTGTAACTCGAGTTACAGCGGAAGATGTGCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-540s1c1
Sequence:CCGGCCGACCAAGAAAGAACTGGAACTCGAGTTCCAGTTCTTTCTTGGTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-435s1c1
Sequence:CCGGAGGAAGCTCATCTTTGGCAAACTCGAGTTTGCCAAAGATGAGCTTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000047166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012227.1-1422s1c1
Sequence:CCGGCTGTATAAGGAGGCCACAGTTCTCGAGAACTGTGGCCTCCTTATACAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000441022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-671s21c1
Sequence:CCGGGCTGCACAGGTCGAACTTGAACTCGAGTTCAAGTTCGACCTGTGCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-577s21c1
Sequence:CCGGAGGTGTTTGACCGCTTCACGGCTCGAGCCGTGAAGCGGTCAAACACCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-1117s21c1
Sequence:CCGGATCTCATCTTGCACGTGAGGGCTCGAGCCCTCACGTGCAAGATGAGATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000437758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012227.1-1375s21c1
Sequence:CCGGAGATCCTCACTCTCCGTGTGACTCGAGTCACACGGAGAGTGAGGATCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???