EMAIL THIS PAGE TO A FRIEND

GTPBP8

GTP-binding protein 8 (putative)

137 Gene Product Result for
Synonyms: HSPC135
UniProtKB ID: Q8N3Z3, A6NE99, A6NN11, A8K0P6, Q5I0Y4
Gene ID:
Mouse(66067) GTP-binding protein 8 (putative)
Rat(360714) GTP-binding protein 8 (putative)
sheep(101122565) GTP-binding protein 8 (putative)
domestic guinea pig(100735551) GTP-binding protein 8 (putative)
naked mole-rat(101723387) GTP-binding protein 8 (putative)
chicken(418366) GTP-binding protein 8 (putative)
dog(607600) GTP-binding protein 8 (putative)
cow(522329) GTP-binding protein 8 (putative)
domestic cat(101097337) GTP-binding protein 8 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138485 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008235 Rosetta Predictions human pricing
NM_001008236 Rosetta Predictions human pricing
NM_014170 Rosetta Predictions human pricing
NM_138485 Rosetta Predictions human pricing
NM_001025015 Rosetta Predictions rat pricing
NM_025332 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155469 predicted 645
2 SASI_Hs01_00155470 predicted 925
3 SASI_Hs01_00155471 predicted 639
4 SASI_Hs01_00155472 predicted 479
5 SASI_Hs01_00155473 predicted 114
6 SASI_Hs01_00155474 predicted 636
7 SASI_Hs01_00155475 predicted 423
8 SASI_Hs01_00155476 predicted 510
9 SASI_Hs01_00155477 predicted 608
10 SASI_Hs01_00155478 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013014 predicted 545
2 SASI_Hs01_00013015 predicted 832
3 SASI_Hs01_00013016 predicted 540
4 SASI_Hs01_00013017 predicted 107
5 SASI_Hs01_00013018 predicted 378
6 SASI_Hs01_00013019 predicted 540
7 SASI_Hs01_00013020 predicted 406
8 SASI_Hs01_00013021 predicted 505
9 SASI_Hs01_00013022 predicted 378
10 SASI_Hs01_00013023 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126146 predicted 681
2 SASI_Hs02_00345169 predicted 705
3 SASI_Hs02_00345170 predicted 684
4 SASI_Hs02_00345171 predicted 695
5 SASI_Hs02_00345172 predicted 684
6 SASI_Hs02_00345173 predicted 688
7 SASI_Hs02_00345174 predicted 692
8 SASI_Hs02_00345175 predicted 687
9 SASI_Hs02_00345176 predicted 697
10 SASI_Hs02_00345177 predicted 696
11 SASI_Hs01_00126144 predicted 1147
12 SASI_Hs01_00126145 predicted 780
13 SASI_Hs01_00126147 predicted 1058
14 SASI_Hs01_00126148 predicted 662
15 SASI_Hs01_00126149 predicted 118
16 SASI_Hs01_00126150 predicted 881
17 SASI_Hs01_00126151 predicted 418
18 SASI_Hs01_00126152 predicted 1179
19 SASI_Hs01_00126153 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146388 predicted 585
2 SASI_Hs02_00363674 predicted 600
3 SASI_Hs02_00363675 predicted 581
4 SASI_Hs02_00363676 predicted 594
5 SASI_Hs02_00363677 predicted 591
6 SASI_Hs02_00363678 predicted 587
7 SASI_Hs02_00363679 predicted 594
8 SASI_Hs02_00363680 predicted 590
9 SASI_Hs02_00363681 predicted 602
10 SASI_Hs02_00363682 predicted 600
11 SASI_Hs01_00146386 predicted 1055
12 SASI_Hs01_00146387 predicted 673
13 SASI_Hs01_00146389 predicted 967
14 SASI_Hs01_00146390 predicted 567
15 SASI_Hs01_00146391 predicted 125
16 SASI_Hs01_00146392 predicted 784
17 SASI_Hs01_00146393 predicted 1086
18 SASI_Hs01_00146394 predicted 632
19 SASI_Hs01_00146395 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075340 predicted 628
2 SASI_Rn01_00075341 predicted 621
3 SASI_Rn01_00075342 predicted 529
4 SASI_Rn01_00075343 predicted 734
5 SASI_Rn01_00075344 predicted 502
6 SASI_Rn01_00075345 predicted 618
7 SASI_Rn01_00075346 predicted 670
8 SASI_Rn01_00075347 predicted 342
9 SASI_Rn01_00075348 predicted 519
10 SASI_Rn02_00202922 predicted 538
11 SASI_Rn01_00075349 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114311 predicted 658
2 SASI_Mm01_00114312 predicted 569
3 SASI_Mm01_00114313 predicted 643
4 SASI_Mm01_00114314 predicted 393
5 SASI_Mm01_00114315 predicted 815
6 SASI_Mm01_00114316 predicted 361
7 SASI_Mm01_00114317 predicted 392
8 SASI_Mm01_00114318 predicted 394
9 SASI_Mm01_00114319 predicted 567
10 SASI_Mm01_00114320 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025332
GTPBP8 MISSION shRNA Bacterial Glycerol Stock
GTP-binding protein 8 (putative)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025332.3-402s21c1
Sequence:CCGGTCTTTGATAAAGGCCTTATTTCTCGAGAAATAAGGCCTTTATCAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025332.3-620s21c1
Sequence:CCGGGGATAGTGTTGTTGGAATTACCTCGAGGTAATTCCAACAACACTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025332.3-647s21c1
Sequence:CCGGAGACAATATTGCCATAGAAATCTCGAGATTTCTATGGCAATATTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-678s1c1
Sequence:CCGGGCATTGCCTTATGTGATGATACTCGAGTATCATCACATAAGGCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-855s1c1
Sequence:CCGGGCAGATATAACAGGAAGTCTTCTCGAGAAGACTTCCTGTTATATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-144s1c1
Sequence:CCGGCAGAAACAGCTAACGAAGGTACTCGAGTACCTTCGTTAGCTGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-749s1c2
Sequence:CCGGCCAGATTCAGAAGTTTGTTAACTCGAGTTAACAAACTTCTGAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025332
GTPBP8 MISSION shRNA shRNA Plasmid DNA
GTP-binding protein 8 (putative)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025332.3-402s21c1
Sequence:CCGGTCTTTGATAAAGGCCTTATTTCTCGAGAAATAAGGCCTTTATCAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025332.3-620s21c1
Sequence:CCGGGGATAGTGTTGTTGGAATTACCTCGAGGTAATTCCAACAACACTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025332.3-647s21c1
Sequence:CCGGAGACAATATTGCCATAGAAATCTCGAGATTTCTATGGCAATATTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-678s1c1
Sequence:CCGGGCATTGCCTTATGTGATGATACTCGAGTATCATCACATAAGGCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-855s1c1
Sequence:CCGGGCAGATATAACAGGAAGTCTTCTCGAGAAGACTTCCTGTTATATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-144s1c1
Sequence:CCGGCAGAAACAGCTAACGAAGGTACTCGAGTACCTTCGTTAGCTGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-749s1c2
Sequence:CCGGCCAGATTCAGAAGTTTGTTAACTCGAGTTAACAAACTTCTGAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025332
GTPBP8 MISSION shRNA Lentiviral Transduction Particles
GTP-binding protein 8 (putative)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025332.3-402s21c1
Sequence:CCGGTCTTTGATAAAGGCCTTATTTCTCGAGAAATAAGGCCTTTATCAAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025332.3-620s21c1
Sequence:CCGGGGATAGTGTTGTTGGAATTACCTCGAGGTAATTCCAACAACACTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025332.3-647s21c1
Sequence:CCGGAGACAATATTGCCATAGAAATCTCGAGATTTCTATGGCAATATTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-678s1c1
Sequence:CCGGGCATTGCCTTATGTGATGATACTCGAGTATCATCACATAAGGCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-855s1c1
Sequence:CCGGGCAGATATAACAGGAAGTCTTCTCGAGAAGACTTCCTGTTATATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-144s1c1
Sequence:CCGGCAGAAACAGCTAACGAAGGTACTCGAGTACCTTCGTTAGCTGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025332.1-749s1c2
Sequence:CCGGCCAGATTCAGAAGTTTGTTAACTCGAGTTAACAAACTTCTGAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138485
GTPBP8 MISSION shRNA Bacterial Glycerol Stock
GTP-binding protein 8 (putative)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-454s21c1
Sequence:CCGGGCTTTAGAGCACCTGAAGATTCTCGAGAATCTTCAGGTGCTCTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-766s21c1
Sequence:CCGGGATGCTTTATAGCCAGTGTAACTCGAGTTACACTGGCTATAAAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138485.1-810s1c1
Sequence:CCGGCCGGTTTAGCTGAAGATTCAACTCGAGTTGAATCTTCAGCTAAACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138485.1-845s1c1
Sequence:CCGGGCTTTATGCTAACTGGAGTTACTCGAGTAACTCCAGTTAGCATAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-766s1c1
Sequence:CCGGGATGCTTTATAGCCAGTGTAACTCGAGTTACACTGGCTATAAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-755s21c1
Sequence:CCGGCCACCTGTTGAGATGCTTTATCTCGAGATAAAGCATCTCAACAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-755s1c1
Sequence:CCGGCCACCTGTTGAGATGCTTTATCTCGAGATAAAGCATCTCAACAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-633s21c1
Sequence:CCGGGACAAATCTTCCAAGGGACATCTCGAGATGTCCCTTGGAAGATTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138485.1-845s21c1
Sequence:CCGGGCTTTATGCTAACTGGAGTTACTCGAGTAACTCCAGTTAGCATAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-454s1c1
Sequence:CCGGGCTTTAGAGCACCTGAAGATTCTCGAGAATCTTCAGGTGCTCTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-633s1c1
Sequence:CCGGGACAAATCTTCCAAGGGACATCTCGAGATGTCCCTTGGAAGATTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138485
GTPBP8 MISSION shRNA shRNA Plasmid DNA
GTP-binding protein 8 (putative)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-454s21c1
Sequence:CCGGGCTTTAGAGCACCTGAAGATTCTCGAGAATCTTCAGGTGCTCTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-766s21c1
Sequence:CCGGGATGCTTTATAGCCAGTGTAACTCGAGTTACACTGGCTATAAAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138485.1-810s1c1
Sequence:CCGGCCGGTTTAGCTGAAGATTCAACTCGAGTTGAATCTTCAGCTAAACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138485.1-845s1c1
Sequence:CCGGGCTTTATGCTAACTGGAGTTACTCGAGTAACTCCAGTTAGCATAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-766s1c1
Sequence:CCGGGATGCTTTATAGCCAGTGTAACTCGAGTTACACTGGCTATAAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-755s21c1
Sequence:CCGGCCACCTGTTGAGATGCTTTATCTCGAGATAAAGCATCTCAACAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-755s1c1
Sequence:CCGGCCACCTGTTGAGATGCTTTATCTCGAGATAAAGCATCTCAACAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-633s21c1
Sequence:CCGGGACAAATCTTCCAAGGGACATCTCGAGATGTCCCTTGGAAGATTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138485.1-845s21c1
Sequence:CCGGGCTTTATGCTAACTGGAGTTACTCGAGTAACTCCAGTTAGCATAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-454s1c1
Sequence:CCGGGCTTTAGAGCACCTGAAGATTCTCGAGAATCTTCAGGTGCTCTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-633s1c1
Sequence:CCGGGACAAATCTTCCAAGGGACATCTCGAGATGTCCCTTGGAAGATTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138485
GTPBP8 MISSION shRNA Lentiviral Transduction Particles
GTP-binding protein 8 (putative)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-454s21c1
Sequence:CCGGGCTTTAGAGCACCTGAAGATTCTCGAGAATCTTCAGGTGCTCTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-766s21c1
Sequence:CCGGGATGCTTTATAGCCAGTGTAACTCGAGTTACACTGGCTATAAAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138485.1-810s1c1
Sequence:CCGGCCGGTTTAGCTGAAGATTCAACTCGAGTTGAATCTTCAGCTAAACCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138485.1-845s1c1
Sequence:CCGGGCTTTATGCTAACTGGAGTTACTCGAGTAACTCCAGTTAGCATAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-766s1c1
Sequence:CCGGGATGCTTTATAGCCAGTGTAACTCGAGTTACACTGGCTATAAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-755s21c1
Sequence:CCGGCCACCTGTTGAGATGCTTTATCTCGAGATAAAGCATCTCAACAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-755s1c1
Sequence:CCGGCCACCTGTTGAGATGCTTTATCTCGAGATAAAGCATCTCAACAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138485.1-633s21c1
Sequence:CCGGGACAAATCTTCCAAGGGACATCTCGAGATGTCCCTTGGAAGATTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138485.1-845s21c1
Sequence:CCGGGCTTTATGCTAACTGGAGTTACTCGAGTAACTCCAGTTAGCATAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-454s1c1
Sequence:CCGGGCTTTAGAGCACCTGAAGATTCTCGAGAATCTTCAGGTGCTCTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138485.1-633s1c1
Sequence:CCGGGACAAATCTTCCAAGGGACATCTCGAGATGTCCCTTGGAAGATTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)