EMAIL THIS PAGE TO A FRIEND

GTSF1

gametocyte specific factor 1

70 Gene Product Result for
Synonyms: FAM112B
UniProtKB ID: Q8WW33, B3KQ60, Q0VGM4, Q8N778
Gene ID:
Mouse(74174) gametocyte specific factor 1
Rat(315347) gametocyte specific factor 1
chicken(771059) gametocyte specific factor 1
cow(506864) gametocyte specific factor 1
domestic cat(101094111) gametocyte specific factor 1
dog(477590) gametocyte-specific factor 1-like
domestic guinea pig(100723203) gametocyte specific factor 1
naked mole-rat(101716163) gametocyte specific factor 1
sheep(101119458) gametocyte specific factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144594 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144594 Rosetta Predictions human pricing
NM_001079707 Rosetta Predictions rat pricing
XM_895110 Rosetta Predictions mouse pricing
XM_917380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183582 predicted 548
2 SASI_Hs01_00183583 predicted 508
3 SASI_Hs01_00183584 predicted 360
4 SASI_Hs01_00183585 predicted 260
5 SASI_Hs01_00183586 predicted 420
6 SASI_Hs01_00183588 predicted 248
7 SASI_Hs01_00183589 predicted 410
8 SASI_Hs01_00183590 predicted 315
9 SASI_Hs01_00183591 predicted 350
10 SASI_Hs02_00364386 predicted 230
11 SASI_Hs01_00183587 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208069 predicted 269
2 SASI_Rn02_00208070 predicted 458
3 SASI_Rn02_00208071 predicted 208
4 SASI_Rn02_00208072 predicted 254
5 SASI_Rn02_00208073 predicted 413
6 SASI_Rn02_00208074 predicted 374
7 SASI_Rn02_00208075 predicted 513
8 SASI_Rn02_00208076 predicted 280
9 SASI_Rn02_00208077 predicted 528
10 SASI_Rn02_00208078 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284270 predicted 246
2 SASI_Mm01_00284271 predicted 233
3 SASI_Mm01_00284272 predicted 505
4 SASI_Mm01_00284273 predicted 238
5 SASI_Mm01_00284274 predicted 388
6 SASI_Mm01_00284275 predicted 443
7 SASI_Mm01_00284276 predicted 506
8 SASI_Mm01_00284277 predicted 219
9 SASI_Mm01_00284278 predicted 513
10 SASI_Mm01_00284279 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441116 predicted 247
2 SASI_Mm02_00441117 predicted 227
3 SASI_Mm02_00441118 predicted 511
4 SASI_Mm02_00441119 predicted 241
5 SASI_Mm02_00441120 predicted 395
6 SASI_Mm02_00441121 predicted 443
7 SASI_Mm02_00441122 predicted 500
8 SASI_Mm02_00441123 predicted 222
9 SASI_Mm02_00441124 predicted 513
10 SASI_Mm02_00441125 predicted 345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144594
GTSF1 MISSION shRNA Bacterial Glycerol Stock
gametocyte specific factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144594.2-537s21c1
Sequence:CCGGCCCAAATCTCTGCCGTATGTTCTCGAGAACATACGGCAGAGATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144594.2-643s21c1
Sequence:CCGGTCTACCAGTGGGTTCTCATTTCTCGAGAAATGAGAACCCACTGGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-185s1c1
Sequence:CCGGGCAAGCAAATTGGCTACTTGTCTCGAGACAAGTAGCCAATTTGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-284s1c1
Sequence:CCGGGAGCAAGATGTTGTCAACCAACTCGAGTTGGTTGACAACATCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-248s1c1
Sequence:CCGGCATCATATCTCAAGCTGTGATCTCGAGATCACAGCTTGAGATATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144594.1-586s1c1
Sequence:CCGGCCTAGAAGACTGTTGCTTCTTCTCGAGAAGAAGCAACAGTCTTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-470s1c1
Sequence:CCGGCATAAGAATAACCTGGCTTCACTCGAGTGAAGCCAGGTTATTCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-233s1c1
Sequence:CCGGCGAGCTGAAATTAGTCATCATCTCGAGATGATGACTAATTTCAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-131s1c1
Sequence:CCGGGCTTGCAGGTTTCCTTATCATCTCGAGATGATAAGGAAACCTGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144594
GTSF1 MISSION shRNA shRNA Plasmid DNA
gametocyte specific factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144594.2-537s21c1
Sequence:CCGGCCCAAATCTCTGCCGTATGTTCTCGAGAACATACGGCAGAGATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144594.2-643s21c1
Sequence:CCGGTCTACCAGTGGGTTCTCATTTCTCGAGAAATGAGAACCCACTGGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-185s1c1
Sequence:CCGGGCAAGCAAATTGGCTACTTGTCTCGAGACAAGTAGCCAATTTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-284s1c1
Sequence:CCGGGAGCAAGATGTTGTCAACCAACTCGAGTTGGTTGACAACATCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-248s1c1
Sequence:CCGGCATCATATCTCAAGCTGTGATCTCGAGATCACAGCTTGAGATATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144594.1-586s1c1
Sequence:CCGGCCTAGAAGACTGTTGCTTCTTCTCGAGAAGAAGCAACAGTCTTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-470s1c1
Sequence:CCGGCATAAGAATAACCTGGCTTCACTCGAGTGAAGCCAGGTTATTCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-233s1c1
Sequence:CCGGCGAGCTGAAATTAGTCATCATCTCGAGATGATGACTAATTTCAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-131s1c1
Sequence:CCGGGCTTGCAGGTTTCCTTATCATCTCGAGATGATAAGGAAACCTGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144594
GTSF1 MISSION shRNA Lentiviral Transduction Particles
gametocyte specific factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144594.2-537s21c1
Sequence:CCGGCCCAAATCTCTGCCGTATGTTCTCGAGAACATACGGCAGAGATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419343    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144594.2-643s21c1
Sequence:CCGGTCTACCAGTGGGTTCTCATTTCTCGAGAAATGAGAACCCACTGGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-185s1c1
Sequence:CCGGGCAAGCAAATTGGCTACTTGTCTCGAGACAAGTAGCCAATTTGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-284s1c1
Sequence:CCGGGAGCAAGATGTTGTCAACCAACTCGAGTTGGTTGACAACATCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-248s1c1
Sequence:CCGGCATCATATCTCAAGCTGTGATCTCGAGATCACAGCTTGAGATATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127892    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144594.1-586s1c1
Sequence:CCGGCCTAGAAGACTGTTGCTTCTTCTCGAGAAGAAGCAACAGTCTTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-470s1c1
Sequence:CCGGCATAAGAATAACCTGGCTTCACTCGAGTGAAGCCAGGTTATTCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-233s1c1
Sequence:CCGGCGAGCTGAAATTAGTCATCATCTCGAGATGATGACTAATTTCAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144594.1-131s1c1
Sequence:CCGGGCTTGCAGGTTTCCTTATCATCTCGAGATGATAAGGAAACCTGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028797
GTSF1 MISSION shRNA Bacterial Glycerol Stock
gametocyte specific factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-185s21c1
Sequence:CCGGCAGGTTTCCTTATCATCTTATCTCGAGATAAGATGATAAGGAAACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-494s21c1
Sequence:CCGGTCCTGCAAATAACATAGTTATCTCGAGATAACTATGTTATTTGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-231s21c1
Sequence:CCGGGTCGCAAACAAATTGGCTACTCTCGAGAGTAGCCAATTTGTTTGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-313s21c1
Sequence:CCGGGTGATGACAAGAGCTGTATTGCTCGAGCAATACAGCTCTTGTCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-552s21c1
Sequence:CCGGCCCAAGTCTCTGCCCTATGTTCTCGAGAACATAGGGCAGAGACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028797
GTSF1 MISSION shRNA shRNA Plasmid DNA
gametocyte specific factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-185s21c1
Sequence:CCGGCAGGTTTCCTTATCATCTTATCTCGAGATAAGATGATAAGGAAACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-494s21c1
Sequence:CCGGTCCTGCAAATAACATAGTTATCTCGAGATAACTATGTTATTTGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-231s21c1
Sequence:CCGGGTCGCAAACAAATTGGCTACTCTCGAGAGTAGCCAATTTGTTTGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-313s21c1
Sequence:CCGGGTGATGACAAGAGCTGTATTGCTCGAGCAATACAGCTCTTGTCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-552s21c1
Sequence:CCGGCCCAAGTCTCTGCCCTATGTTCTCGAGAACATAGGGCAGAGACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028797
GTSF1 MISSION shRNA Lentiviral Transduction Particles
gametocyte specific factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-185s21c1
Sequence:CCGGCAGGTTTCCTTATCATCTTATCTCGAGATAAGATGATAAGGAAACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-494s21c1
Sequence:CCGGTCCTGCAAATAACATAGTTATCTCGAGATAACTATGTTATTTGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-231s21c1
Sequence:CCGGGTCGCAAACAAATTGGCTACTCTCGAGAGTAGCCAATTTGTTTGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-313s21c1
Sequence:CCGGGTGATGACAAGAGCTGTATTGCTCGAGCAATACAGCTCTTGTCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028797.1-552s21c1
Sequence:CCGGCCCAAGTCTCTGCCCTATGTTCTCGAGAACATAGGGCAGAGACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)