EMAIL THIS PAGE TO A FRIEND

GTSF1L

gametocyte specific factor 1-like

73 Gene Product Result for
Synonyms: C20orf65 FAM112A dJ1028D15.4
UniProtKB ID: Q9H1H1, Q5JWH5
Gene ID:
Mouse(68236) gametocyte specific factor 1-like
Rat(366244) gametocyte specific factor 1-like
sheep(101107620) gametocyte specific factor 1-like
domestic guinea pig(100735542) gametocyte specific factor 1-like
naked mole-rat(101715503) gametocyte specific factor 1-like
cow(524670) gametocyte specific factor 1-like
domestic cat(101095001) gametocyte specific factor 1-like
dog(100687214) gametocyte specific factor 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_176791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176791 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055011 MISSION® esiRNA esiRNA human FAM112A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008901 Rosetta Predictions human pricing
NM_176791 Rosetta Predictions human pricing
XM_345466 Rosetta Predictions rat pricing
XR_008691 Rosetta Predictions rat pricing
NM_026630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082451 predicted 310
2 SASI_Hs01_00082452 predicted 352
3 SASI_Hs01_00082453 predicted 352
4 SASI_Hs01_00082454 predicted 325
5 SASI_Hs01_00082455 predicted 306
6 SASI_Hs01_00082457 predicted 358
7 SASI_Hs01_00082448 predicted 316
8 SASI_Hs01_00082449 predicted 341
9 SASI_Hs01_00082450 predicted 317
10 SASI_Hs02_00305596 predicted 326
11 SASI_Hs01_00082456 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104781 predicted 311
2 SASI_Hs01_00104782 predicted 354
3 SASI_Hs01_00104783 predicted 359
4 SASI_Hs01_00104784 predicted 333
5 SASI_Hs01_00104785 predicted 310
6 SASI_Hs01_00104787 predicted 356
7 SASI_Hs01_00104778 predicted 318
8 SASI_Hs01_00104779 predicted 344
9 SASI_Hs01_00104780 predicted 316
10 SASI_Hs02_00369215 predicted 319
11 SASI_Hs01_00104786 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136989 predicted 19
2 SASI_Rn01_00136990 predicted 43
3 SASI_Rn01_00136991 predicted 181
4 SASI_Rn01_00136992 predicted 14
5 SASI_Rn01_00136993 predicted 165
6 SASI_Rn01_00136994 predicted 43
7 SASI_Rn01_00136995 predicted 49
8 SASI_Rn01_00136996 predicted 183
9 SASI_Rn01_00136997 predicted 187
10 SASI_Rn01_00136998 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00137211 predicted 264
2 SASI_Rn01_00137212 predicted 295
3 SASI_Rn01_00137213 predicted 248
4 SASI_Rn01_00137214 predicted 243
5 SASI_Rn01_00137215 predicted 215
6 SASI_Rn01_00137216 predicted 361
7 SASI_Rn01_00137217 predicted 219
8 SASI_Rn02_00417670 predicted 285
9 SASI_Rn01_00137218 predicted 198
10 SASI_Rn01_00137219 predicted 294
11 SASI_Rn01_00137220 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130731 predicted 597
2 SASI_Mm01_00130732 predicted 616
3 SASI_Mm01_00130733 predicted 390
4 SASI_Mm01_00130734 predicted 597
5 SASI_Mm01_00130735 predicted 612
6 SASI_Mm01_00130736 predicted 386
7 SASI_Mm01_00130737 predicted 612
8 SASI_Mm01_00130738 predicted 662
9 SASI_Mm01_00130739 predicted 832
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026630
GTSF1L MISSION shRNA Bacterial Glycerol Stock
gametocyte specific factor 1-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-494s21c1
Sequence:CCGGCACGTGGTTCCCATCAGAAAGCTCGAGCTTTCTGATGGGAACCACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-720s1c1
Sequence:CCGGGTTTGTGAAAGTGACATCCAACTCGAGTTGGATGTCACTTTCACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-726s1c1
Sequence:CCGGGAAAGTGACATCCAAGAGTCACTCGAGTGACTCTTGGATGTCACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-380s21c1
Sequence:CCGGTATAACCCTCACCACCGAATCCTCGAGGATTCGGTGGTGAGGGTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-619s21c1
Sequence:CCGGACTACAGGTTCGTTGGCTTTCCTCGAGGAAAGCCAACGAACCTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-642s21c1
Sequence:CCGGACCCTGACATTTGGAATGTTGCTCGAGCAACATTCCAAATGTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-472s1c1
Sequence:CCGGCCAGCTGTAAATACAACGCCTCTCGAGAGGCGTTGTATTTACAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-681s1c1
Sequence:CCGGCCAATGTTCGTCCTTAAGAGTCTCGAGACTCTTAAGGACGAACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-571s21c1
Sequence:CCGGATTAGGCCCTCTGCAAGTCAGCTCGAGCTGACTTGCAGAGGGCCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026630
GTSF1L MISSION shRNA shRNA Plasmid DNA
gametocyte specific factor 1-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-494s21c1
Sequence:CCGGCACGTGGTTCCCATCAGAAAGCTCGAGCTTTCTGATGGGAACCACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-720s1c1
Sequence:CCGGGTTTGTGAAAGTGACATCCAACTCGAGTTGGATGTCACTTTCACAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-726s1c1
Sequence:CCGGGAAAGTGACATCCAAGAGTCACTCGAGTGACTCTTGGATGTCACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-380s21c1
Sequence:CCGGTATAACCCTCACCACCGAATCCTCGAGGATTCGGTGGTGAGGGTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-619s21c1
Sequence:CCGGACTACAGGTTCGTTGGCTTTCCTCGAGGAAAGCCAACGAACCTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-642s21c1
Sequence:CCGGACCCTGACATTTGGAATGTTGCTCGAGCAACATTCCAAATGTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-472s1c1
Sequence:CCGGCCAGCTGTAAATACAACGCCTCTCGAGAGGCGTTGTATTTACAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-681s1c1
Sequence:CCGGCCAATGTTCGTCCTTAAGAGTCTCGAGACTCTTAAGGACGAACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-571s21c1
Sequence:CCGGATTAGGCCCTCTGCAAGTCAGCTCGAGCTGACTTGCAGAGGGCCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026630
GTSF1L MISSION shRNA Lentiviral Transduction Particles
gametocyte specific factor 1-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-494s21c1
Sequence:CCGGCACGTGGTTCCCATCAGAAAGCTCGAGCTTTCTGATGGGAACCACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-720s1c1
Sequence:CCGGGTTTGTGAAAGTGACATCCAACTCGAGTTGGATGTCACTTTCACAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-726s1c1
Sequence:CCGGGAAAGTGACATCCAAGAGTCACTCGAGTGACTCTTGGATGTCACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-380s21c1
Sequence:CCGGTATAACCCTCACCACCGAATCCTCGAGGATTCGGTGGTGAGGGTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-619s21c1
Sequence:CCGGACTACAGGTTCGTTGGCTTTCCTCGAGGAAAGCCAACGAACCTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-642s21c1
Sequence:CCGGACCCTGACATTTGGAATGTTGCTCGAGCAACATTCCAAATGTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-472s1c1
Sequence:CCGGCCAGCTGTAAATACAACGCCTCTCGAGAGGCGTTGTATTTACAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026630.1-681s1c1
Sequence:CCGGCCAATGTTCGTCCTTAAGAGTCTCGAGACTCTTAAGGACGAACATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026630.2-571s21c1
Sequence:CCGGATTAGGCCCTCTGCAAGTCAGCTCGAGCTGACTTGCAGAGGGCCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176791
GTSF1L MISSION shRNA Bacterial Glycerol Stock
gametocyte specific factor 1-like
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-641s21c1
Sequence:CCGGCCAGCATGTGTTTGTCCTTAACTCGAGTTAAGGACAAACACATGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-526s21c1
Sequence:CCGGACACCGAGAACCCTCTGAAAGCTCGAGCTTTCAGAGGGTTCTCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176791.2-456s1c1
Sequence:CCGGGAGAACCCTCTGAAAGTCAGTCTCGAGACTGACTTTCAGAGGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-619s21c1
Sequence:CCGGGGAATGTCGATGGCGCTAATTCTCGAGAATTAGCGCCATCGACATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-476s21c1
Sequence:CCGGGGAGGAACATGAGGCTGTTTGCTCGAGCAAACAGCCTCATGTTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-339s21c1
Sequence:CCGGTATGATCCTCACCACCGAATCCTCGAGGATTCGGTGGTGAGGATCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176791
GTSF1L MISSION shRNA shRNA Plasmid DNA
gametocyte specific factor 1-like
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-641s21c1
Sequence:CCGGCCAGCATGTGTTTGTCCTTAACTCGAGTTAAGGACAAACACATGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-526s21c1
Sequence:CCGGACACCGAGAACCCTCTGAAAGCTCGAGCTTTCAGAGGGTTCTCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176791.2-456s1c1
Sequence:CCGGGAGAACCCTCTGAAAGTCAGTCTCGAGACTGACTTTCAGAGGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-619s21c1
Sequence:CCGGGGAATGTCGATGGCGCTAATTCTCGAGAATTAGCGCCATCGACATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-476s21c1
Sequence:CCGGGGAGGAACATGAGGCTGTTTGCTCGAGCAAACAGCCTCATGTTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-339s21c1
Sequence:CCGGTATGATCCTCACCACCGAATCCTCGAGGATTCGGTGGTGAGGATCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176791
GTSF1L MISSION shRNA Lentiviral Transduction Particles
gametocyte specific factor 1-like
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-641s21c1
Sequence:CCGGCCAGCATGTGTTTGTCCTTAACTCGAGTTAAGGACAAACACATGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-526s21c1
Sequence:CCGGACACCGAGAACCCTCTGAAAGCTCGAGCTTTCAGAGGGTTCTCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176791.2-456s1c1
Sequence:CCGGGAGAACCCTCTGAAAGTCAGTCTCGAGACTGACTTTCAGAGGGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-619s21c1
Sequence:CCGGGGAATGTCGATGGCGCTAATTCTCGAGAATTAGCGCCATCGACATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-476s21c1
Sequence:CCGGGGAGGAACATGAGGCTGTTTGCTCGAGCAAACAGCCTCATGTTCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176791.3-339s21c1
Sequence:CCGGTATGATCCTCACCACCGAATCCTCGAGGATTCGGTGGTGAGGATCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)