EMAIL THIS PAGE TO A FRIEND

GUCA1B

guanylate cyclase activator 1B (retina)

48 Gene Product Result for
Synonyms: GCAP2 GUCA2 RP48
UniProtKB ID: Q9UMX6, Q9NU15
Gene ID:
Human(2979) Summary: The protein encoded by this gene is a calcium-binding protein that activates photoreceptor guanylate cyclases. This gene may have arisen due to a gene duplication event since there is a highly similar gene clustered with it on chromosome 6. Mutations in this gene can cause a form of retinitis pigmentosa. [provided by RefSeq, Nov 2009]
Mouse(107477) guanylate cyclase activator 1B
Rat(316218) guanylate cyclase activator 1B
sheep(101108609) guanylate cyclase activator 1B (retina)
domestic guinea pig(100714867) guanylate cyclase activator 1B (retina)
naked mole-rat(101705513) guanylate cyclase activator 1B (retina)
Zebrafish(140431) guanylate cyclase activator 1B
cow(286851) guanylate cyclase activator 1B (retina)
domestic cat(101080634) guanylate cyclase activator 1B (retina)
dog(481801) guanylate cyclase activator 1B (retina)
chicken(419864) guanylate cyclase activator 1B (retina)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002098 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002098 Rosetta Predictions human pricing
NM_001108198 Rosetta Predictions rat pricing
NM_146079 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092567 predicted 298
2 SASI_Hs01_00092569 predicted 237
3 SASI_Hs02_00333202 predicted 721
4 SASI_Hs01_00092571 predicted 244
5 SASI_Hs01_00092572 predicted 898
6 SASI_Hs02_00333203 predicted 489
7 SASI_Hs01_00092573 predicted 249
8 SASI_Hs01_00092570 predicted 418
9 SASI_Hs01_00092574 predicted 764
10 SASI_Hs02_00333204 predicted 206
11 SASI_Hs01_00092568 predicted 617
12 SASI_Hs01_00092575 predicted 619
13 SASI_Hs01_00092576 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236284 predicted 213
2 SASI_Rn02_00236285 predicted 1073
3 SASI_Rn02_00236286 predicted 195
4 SASI_Rn02_00236287 predicted 804
5 SASI_Rn02_00236288 predicted 302
6 SASI_Rn02_00236289 predicted 413
7 SASI_Rn02_00236290 predicted 904
8 SASI_Rn02_00236291 predicted 1044
9 SASI_Rn02_00236292 predicted 317
10 SASI_Rn02_00236293 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030610 predicted 1170
2 SASI_Mm01_00030611 predicted 200
3 SASI_Mm01_00030612 predicted 571
4 SASI_Mm01_00030613 predicted 312
5 SASI_Mm01_00030614 predicted 793
6 SASI_Mm01_00030615 predicted 608
7 SASI_Mm01_00030616 predicted 1020
8 SASI_Mm01_00030617 predicted 618
9 SASI_Mm01_00030618 predicted 825
10 SASI_Mm01_00030619 predicted 1020
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002098
GUCA1B MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase activator 1B (retina)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002098.5-772s21c1
Sequence:CCGGACCCAGGTTTCCAGGGTAGTACTCGAGTACTACCCTGGAAACCTGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-64s1c1
Sequence:CCGGCAGGAGTGGTACAAGAAGTTTCTCGAGAAACTTCTTGTACCACTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-165s1c1
Sequence:CCGGCCAGTATGTAGAGGGCATGTTCTCGAGAACATGCCCTCTACATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-279s1c1
Sequence:CCGGGCTGAAGTGGACATTCAAGATCTCGAGATCTTGAATGTCCACTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-343s1c1
Sequence:CCGGCTCAACATTGTGGAGGGAATTCTCGAGAATTCCCTCCACAATGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-297s1c1
Sequence:CCGGGATCTATGATAAGGATGGCAACTCGAGTTGCCATCCTTATCATAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002098.5-243s21c1
Sequence:CCGGCACTCTTTATGCATGAGTTTACTCGAGTAAACTCATGCATAAAGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002098
GUCA1B MISSION shRNA shRNA Plasmid DNA
guanylate cyclase activator 1B (retina)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002098.5-772s21c1
Sequence:CCGGACCCAGGTTTCCAGGGTAGTACTCGAGTACTACCCTGGAAACCTGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-64s1c1
Sequence:CCGGCAGGAGTGGTACAAGAAGTTTCTCGAGAAACTTCTTGTACCACTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-165s1c1
Sequence:CCGGCCAGTATGTAGAGGGCATGTTCTCGAGAACATGCCCTCTACATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-279s1c1
Sequence:CCGGGCTGAAGTGGACATTCAAGATCTCGAGATCTTGAATGTCCACTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-343s1c1
Sequence:CCGGCTCAACATTGTGGAGGGAATTCTCGAGAATTCCCTCCACAATGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-297s1c1
Sequence:CCGGGATCTATGATAAGGATGGCAACTCGAGTTGCCATCCTTATCATAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002098.5-243s21c1
Sequence:CCGGCACTCTTTATGCATGAGTTTACTCGAGTAAACTCATGCATAAAGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002098
GUCA1B MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase activator 1B (retina)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002098.5-772s21c1
Sequence:CCGGACCCAGGTTTCCAGGGTAGTACTCGAGTACTACCCTGGAAACCTGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-64s1c1
Sequence:CCGGCAGGAGTGGTACAAGAAGTTTCTCGAGAAACTTCTTGTACCACTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-165s1c1
Sequence:CCGGCCAGTATGTAGAGGGCATGTTCTCGAGAACATGCCCTCTACATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-279s1c1
Sequence:CCGGGCTGAAGTGGACATTCAAGATCTCGAGATCTTGAATGTCCACTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-343s1c1
Sequence:CCGGCTCAACATTGTGGAGGGAATTCTCGAGAATTCCCTCCACAATGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002098.2-297s1c1
Sequence:CCGGGATCTATGATAAGGATGGCAACTCGAGTTGCCATCCTTATCATAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002098.5-243s21c1
Sequence:CCGGCACTCTTTATGCATGAGTTTACTCGAGTAAACTCATGCATAAAGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146079
GUCA1B MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase activator 1B (retina)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146079.1-1419s1c1
Sequence:CCGGGCTTCCAGTTATCCCGCAAATCTCGAGATTTGCGGGATAACTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-205s1c1
Sequence:CCGGGCTCTTCATGCACGAGTTCAACTCGAGTTGAACTCGTGCATGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-455s1c1
Sequence:CCGGGCGATTTACAAGCTGAAGAAACTCGAGTTTCTTCAGCTTGTAAATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-631s1c1
Sequence:CCGGGAAGATGCTACAAATGGATATCTCGAGATATCCATTTGTAGCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-623s1c1
Sequence:CCGGTGGGTAATGAAGATGCTACAACTCGAGTTGTAGCATCTTCATTACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146079
GUCA1B MISSION shRNA shRNA Plasmid DNA
guanylate cyclase activator 1B (retina)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146079.1-1419s1c1
Sequence:CCGGGCTTCCAGTTATCCCGCAAATCTCGAGATTTGCGGGATAACTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-205s1c1
Sequence:CCGGGCTCTTCATGCACGAGTTCAACTCGAGTTGAACTCGTGCATGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-455s1c1
Sequence:CCGGGCGATTTACAAGCTGAAGAAACTCGAGTTTCTTCAGCTTGTAAATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-631s1c1
Sequence:CCGGGAAGATGCTACAAATGGATATCTCGAGATATCCATTTGTAGCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-623s1c1
Sequence:CCGGTGGGTAATGAAGATGCTACAACTCGAGTTGTAGCATCTTCATTACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146079
GUCA1B MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase activator 1B (retina)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146079.1-1419s1c1
Sequence:CCGGGCTTCCAGTTATCCCGCAAATCTCGAGATTTGCGGGATAACTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-205s1c1
Sequence:CCGGGCTCTTCATGCACGAGTTCAACTCGAGTTGAACTCGTGCATGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-455s1c1
Sequence:CCGGGCGATTTACAAGCTGAAGAAACTCGAGTTTCTTCAGCTTGTAAATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-631s1c1
Sequence:CCGGGAAGATGCTACAAATGGATATCTCGAGATATCCATTTGTAGCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146079.1-623s1c1
Sequence:CCGGTGGGTAATGAAGATGCTACAACTCGAGTTGTAGCATCTTCATTACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)