EMAIL THIS PAGE TO A FRIEND

GUCA1C

guanylate cyclase activator 1C

71 Gene Product Result for
Synonyms: GCAP3
UniProtKB ID: O95843, O95844, Q9UNM0
Gene ID:
Zebrafish(373099) guanylate cyclase activator 1C
domestic cat(101084309) guanylate cyclase activator 1C
dog(487968) guanylate cyclase activator 1C
chicken(427960) guanylate cyclase activator 1C
sheep(101112447) guanylate cyclase activator 1C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005459 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097301 MISSION® esiRNA esiRNA human GUCA1C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005459 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173116 predicted 304
2 SASI_Hs01_00173117 predicted 498
3 SASI_Hs01_00173118 predicted 537
4 SASI_Hs01_00173119 predicted 573
5 SASI_Hs01_00173120 predicted 419
6 SASI_Hs01_00173121 predicted 198
7 SASI_Hs01_00173122 predicted 399
8 SASI_Hs01_00173123 predicted 420
9 SASI_Hs01_00173124 predicted 205
10 SASI_Hs01_00173125 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005459
GUCA1C MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase activator 1C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-68s1c1
Sequence:CCGGCCATGTGTGGTACAGAACATTCTCGAGAATGTTCTGTACCACACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-315s1c1
Sequence:CCGGGCTGATGGAAATGGTTCTATTCTCGAGAATAGAACCATTTCCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-249s1c1
Sequence:CCGGGCTGTAAATCTAATCATGCAACTCGAGTTGCATGATTAGATTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-111s1c1
Sequence:CCGGCTGCAAACACTACATGAATTTCTCGAGAAATTCATGTAGTGTTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-548s1c1
Sequence:CCGGGAGAGTAATCTGTAATGGGAACTCGAGTTCCCATTACAGATTACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005459.3-557s21c1
Sequence:CCGGGGATCTCCTGGAGATTGTTTACTCGAGTAAACAATCTCCAGGAGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005459.3-720s21c1
Sequence:CCGGCTATCAATGAGCACAACATTTCTCGAGAAATGTTGTGCTCATTGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005459.3-481s21c1
Sequence:CCGGTGTTCCATAAGATCGATATAACTCGAGTTATATCGATCTTATGGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005459
GUCA1C MISSION shRNA shRNA Plasmid DNA
guanylate cyclase activator 1C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-68s1c1
Sequence:CCGGCCATGTGTGGTACAGAACATTCTCGAGAATGTTCTGTACCACACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-315s1c1
Sequence:CCGGGCTGATGGAAATGGTTCTATTCTCGAGAATAGAACCATTTCCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-249s1c1
Sequence:CCGGGCTGTAAATCTAATCATGCAACTCGAGTTGCATGATTAGATTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-111s1c1
Sequence:CCGGCTGCAAACACTACATGAATTTCTCGAGAAATTCATGTAGTGTTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-548s1c1
Sequence:CCGGGAGAGTAATCTGTAATGGGAACTCGAGTTCCCATTACAGATTACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005459.3-557s21c1
Sequence:CCGGGGATCTCCTGGAGATTGTTTACTCGAGTAAACAATCTCCAGGAGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005459.3-720s21c1
Sequence:CCGGCTATCAATGAGCACAACATTTCTCGAGAAATGTTGTGCTCATTGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005459.3-481s21c1
Sequence:CCGGTGTTCCATAAGATCGATATAACTCGAGTTATATCGATCTTATGGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005459
GUCA1C MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase activator 1C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-68s1c1
Sequence:CCGGCCATGTGTGGTACAGAACATTCTCGAGAATGTTCTGTACCACACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-315s1c1
Sequence:CCGGGCTGATGGAAATGGTTCTATTCTCGAGAATAGAACCATTTCCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-249s1c1
Sequence:CCGGGCTGTAAATCTAATCATGCAACTCGAGTTGCATGATTAGATTTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-111s1c1
Sequence:CCGGCTGCAAACACTACATGAATTTCTCGAGAAATTCATGTAGTGTTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005459.2-548s1c1
Sequence:CCGGGAGAGTAATCTGTAATGGGAACTCGAGTTCCCATTACAGATTACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005459.3-557s21c1
Sequence:CCGGGGATCTCCTGGAGATTGTTTACTCGAGTAAACAATCTCCAGGAGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420117    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005459.3-720s21c1
Sequence:CCGGCTATCAATGAGCACAACATTTCTCGAGAAATGTTGTGCTCATTGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005459.3-481s21c1
Sequence:CCGGTGTTCCATAAGATCGATATAACTCGAGTTATATCGATCTTATGGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)