EMAIL THIS PAGE TO A FRIEND

GUCA2A

guanylate cyclase activator 2A (guanylin)

51 Gene Product Result for
Synonyms: GCAP-I GUCA2 STARA
UniProtKB ID: Q02747
Gene ID:
Mouse(14915) guanylate cyclase activator 2a (guanylin)
Rat(25656) guanylate cyclase activator 2a (guanylin)
chicken(419498) guanylate cyclase activator 2A (guanylin)
dog(482446) guanylate cyclase activator 2A (guanylin)
cow(531794) guanylate cyclase activator 2A (guanylin)
domestic cat(101092627) guanylate cyclase activator 2A (guanylin)
domestic guinea pig(100135534) guanylate cyclase activator 2a (guanylin)
naked mole-rat(101720679) guanylate cyclase activator 2A (guanylin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
K3375 Kynurenic acid ≥98% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033553 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008190 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008190 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008190 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033553 Rosetta Predictions human pricing
NM_013118 Rosetta Predictions rat pricing
NM_008190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241961 predicted 302
2 SASI_Hs01_00241962 predicted 199
3 SASI_Hs01_00241963 predicted 286
4 SASI_Hs02_00361428 predicted 280
5 SASI_Hs01_00241964 predicted 313
6 SASI_Hs01_00241965 predicted 213
7 SASI_Hs01_00241968 predicted 300
8 SASI_Hs01_00241969 predicted 300
9 SASI_Hs01_00241970 predicted 264
10 SASI_Hs02_00361429 predicted 334
11 SASI_Hs01_00241966 predicted 279
12 SASI_Hs01_00241967 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074636 predicted 210
2 SASI_Rn01_00074637 predicted 307
3 SASI_Rn01_00074638 predicted 206
4 SASI_Rn01_00074639 predicted 280
5 SASI_Rn01_00074640 predicted 297
6 SASI_Rn01_00074641 predicted 306
7 SASI_Rn01_00074642 predicted 269
8 SASI_Rn01_00074643 predicted 319
9 SASI_Rn01_00074644 predicted 218
10 SASI_Rn01_00074645 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313332 predicted 247
2 SASI_Mm01_00136933 predicted 303
3 SASI_Mm01_00136934 predicted 245
4 SASI_Mm01_00136935 predicted 296
5 SASI_Mm01_00136936 predicted 201
6 SASI_Mm01_00136937 predicted 204
7 SASI_Mm01_00136938 predicted 281
8 SASI_Mm01_00136939 predicted 211
9 SASI_Mm01_00136940 predicted 202
10 SASI_Mm01_00136941 predicted 322
11 SASI_Mm01_00136942 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033553
GUCA2A MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase activator 2A (guanylin)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033553.2-113s21c1
Sequence:CCGGAGTCAGTGAAGAAGCTCAAAGCTCGAGCTTTGAGCTTCTTCACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033553.2-282s21c1
Sequence:CCGGACTTCAGAGGCTGGAGGAAATCTCGAGATTTCCTCCAGCCTCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-250s1c2
Sequence:CCGGCCTCTCTGCAAGGAGCCCAATCTCGAGATTGGGCTCCTTGCAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-214s1c1
Sequence:CCGGCTCTGTAGCAACCCGAACTTTCTCGAGAAAGTTCGGGTTGCTACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-225s1c1
Sequence:CCGGCCCGAACTTTCCAGAAGAACTCTCGAGAGTTCTTCTGGAAAGTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-339s1c1
Sequence:CCGGCGCTGCCTGTACCGGATGCTACTCGAGTAGCATCCGGTACAGGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-80s1c1
Sequence:CCGGCCGTGCAGGATGGAAATTTCTCTCGAGAGAAATTTCCATCCTGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033553
GUCA2A MISSION shRNA shRNA Plasmid DNA
guanylate cyclase activator 2A (guanylin)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033553.2-113s21c1
Sequence:CCGGAGTCAGTGAAGAAGCTCAAAGCTCGAGCTTTGAGCTTCTTCACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033553.2-282s21c1
Sequence:CCGGACTTCAGAGGCTGGAGGAAATCTCGAGATTTCCTCCAGCCTCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-250s1c2
Sequence:CCGGCCTCTCTGCAAGGAGCCCAATCTCGAGATTGGGCTCCTTGCAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-214s1c1
Sequence:CCGGCTCTGTAGCAACCCGAACTTTCTCGAGAAAGTTCGGGTTGCTACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-225s1c1
Sequence:CCGGCCCGAACTTTCCAGAAGAACTCTCGAGAGTTCTTCTGGAAAGTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-339s1c1
Sequence:CCGGCGCTGCCTGTACCGGATGCTACTCGAGTAGCATCCGGTACAGGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-80s1c1
Sequence:CCGGCCGTGCAGGATGGAAATTTCTCTCGAGAGAAATTTCCATCCTGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033553
GUCA2A MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase activator 2A (guanylin)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033553.2-113s21c1
Sequence:CCGGAGTCAGTGAAGAAGCTCAAAGCTCGAGCTTTGAGCTTCTTCACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033553.2-282s21c1
Sequence:CCGGACTTCAGAGGCTGGAGGAAATCTCGAGATTTCCTCCAGCCTCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-250s1c2
Sequence:CCGGCCTCTCTGCAAGGAGCCCAATCTCGAGATTGGGCTCCTTGCAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-214s1c1
Sequence:CCGGCTCTGTAGCAACCCGAACTTTCTCGAGAAAGTTCGGGTTGCTACAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-225s1c1
Sequence:CCGGCCCGAACTTTCCAGAAGAACTCTCGAGAGTTCTTCTGGAAAGTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-339s1c1
Sequence:CCGGCGCTGCCTGTACCGGATGCTACTCGAGTAGCATCCGGTACAGGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033553.2-80s1c1
Sequence:CCGGCCGTGCAGGATGGAAATTTCTCTCGAGAGAAATTTCCATCCTGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008190
GUCA2A MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase activator 2A (guanylin)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008190.1-410s1c1
Sequence:CCGGCCCTCTATCTTCTAGAAGTCACTCGAGTGACTTCTAGAAGATAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-167s1c1
Sequence:CCGGCTGGTGAGTCACAAGAAGTTTCTCGAGAAACTTCTTGTGACTCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-216s1c1
Sequence:CCGGCACAGCTATGTAGTAGCCACTCTCGAGAGTGGCTACTACATAGCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-271s1c1
Sequence:CCGGGAAACCCAACGCCGAGGAGATCTCGAGATCTCCTCGGCGTTGGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-328s1c1
Sequence:CCGGCACATGTGAGATCTGTGCCTACTCGAGTAGGCACAGATCTCACATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008190
GUCA2A MISSION shRNA shRNA Plasmid DNA
guanylate cyclase activator 2A (guanylin)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008190.1-410s1c1
Sequence:CCGGCCCTCTATCTTCTAGAAGTCACTCGAGTGACTTCTAGAAGATAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-167s1c1
Sequence:CCGGCTGGTGAGTCACAAGAAGTTTCTCGAGAAACTTCTTGTGACTCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-216s1c1
Sequence:CCGGCACAGCTATGTAGTAGCCACTCTCGAGAGTGGCTACTACATAGCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-271s1c1
Sequence:CCGGGAAACCCAACGCCGAGGAGATCTCGAGATCTCCTCGGCGTTGGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-328s1c1
Sequence:CCGGCACATGTGAGATCTGTGCCTACTCGAGTAGGCACAGATCTCACATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008190
GUCA2A MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase activator 2A (guanylin)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008190.1-410s1c1
Sequence:CCGGCCCTCTATCTTCTAGAAGTCACTCGAGTGACTTCTAGAAGATAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-167s1c1
Sequence:CCGGCTGGTGAGTCACAAGAAGTTTCTCGAGAAACTTCTTGTGACTCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-216s1c1
Sequence:CCGGCACAGCTATGTAGTAGCCACTCTCGAGAGTGGCTACTACATAGCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-271s1c1
Sequence:CCGGGAAACCCAACGCCGAGGAGATCTCGAGATCTCCTCGGCGTTGGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008190.1-328s1c1
Sequence:CCGGCACATGTGAGATCTGTGCCTACTCGAGTAGGCACAGATCTCACATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)