EMAIL THIS PAGE TO A FRIEND

GUCD1

guanylyl cyclase domain containing 1

62 Gene Product Result for
Synonyms: C22orf13 LLN4
UniProtKB ID: Q96NT3, B5MCB8, Q96Q79, Q9BU32
Gene ID:
Mouse(68778) guanylyl cyclase domain containing 1
Rat(687713) guanylyl cyclase domain containing 1
Zebrafish(564677) guanylyl cyclase domain containing 1
sheep(101112677) guanylyl cyclase domain containing 1
domestic guinea pig(100721471) guanylyl cyclase domain containing 1
naked mole-rat(101720260) guanylyl cyclase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_371459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371459 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031444 Rosetta Predictions human pricing
NM_001134997 Rosetta Predictions rat pricing
NM_175133 Rosetta Predictions mouse pricing
XM_483920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190136 predicted 975
2 SASI_Hs01_00190138 predicted 1327
3 SASI_Hs01_00190139 predicted 1129
4 SASI_Hs01_00190140 predicted 929
5 SASI_Hs01_00190141 predicted 593
6 SASI_Hs01_00190143 predicted 936
7 SASI_Hs01_00190144 predicted 983
8 SASI_Hs02_00358853 predicted 530
9 SASI_Hs01_00190145 predicted 999
10 SASI_Hs02_00358854 predicted 582
11 SASI_Hs01_00190137 predicted 1388
12 SASI_Hs01_00190142 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259347 predicted 469
2 SASI_Rn02_00259348 predicted 664
3 SASI_Rn02_00259349 predicted 1072
4 SASI_Rn02_00259350 predicted 398
5 SASI_Rn02_00259351 predicted 438
6 SASI_Rn02_00259352 predicted 281
7 SASI_Rn02_00259353 predicted 1055
8 SASI_Rn02_00259354 predicted 564
9 SASI_Rn02_00259355 predicted 470
10 SASI_Rn02_00259356 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345747 predicted 354
2 SASI_Mm02_00345748 predicted 1070
3 SASI_Mm02_00345749 predicted 479
4 SASI_Mm02_00345750 predicted 391
5 SASI_Mm02_00345751 predicted 309
6 SASI_Mm02_00345752 predicted 581
7 SASI_Mm02_00345753 predicted 1007
8 SASI_Mm02_00345754 predicted 734
9 SASI_Mm02_00345755 predicted 998
10 SASI_Mm02_00345756 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_483920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236049 predicted 456
2 SASI_Mm01_00236050 predicted 1176
3 SASI_Mm01_00236051 predicted 585
4 SASI_Mm01_00236052 predicted 496
5 SASI_Mm01_00236053 predicted 407
6 SASI_Mm01_00236054 predicted 685
7 SASI_Mm01_00236055 predicted 620
8 SASI_Mm01_00236056 predicted 1114
9 SASI_Mm01_00236057 predicted 1108
10 SASI_Mm01_00236058 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175133
GUCD1 MISSION shRNA Bacterial Glycerol Stock
guanylyl cyclase domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-714s21c1
Sequence:CCGGTACCGGCTGCATCTTCTATAACTCGAGTTATAGAAGATGCAGCCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-687s21c1
Sequence:CCGGCATCGTCCTGCGTGGCTATAACTCGAGTTATAGCCACGCAGGACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175133.1-2153s21c1
Sequence:CCGGCAAGTCCAGTCACCCATATTACTCGAGTAATATGGGTGACTGGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-760s21c1
Sequence:CCGGTGCAGCACCAGCATCAGTAACCTCGAGGTTACTGATGCTGGTGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-194s21c1
Sequence:CCGGCTATCATCCAGCAGCTATATCCTCGAGGATATAGCTGCTGGATGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175133
GUCD1 MISSION shRNA shRNA Plasmid DNA
guanylyl cyclase domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-714s21c1
Sequence:CCGGTACCGGCTGCATCTTCTATAACTCGAGTTATAGAAGATGCAGCCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-687s21c1
Sequence:CCGGCATCGTCCTGCGTGGCTATAACTCGAGTTATAGCCACGCAGGACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175133.1-2153s21c1
Sequence:CCGGCAAGTCCAGTCACCCATATTACTCGAGTAATATGGGTGACTGGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-760s21c1
Sequence:CCGGTGCAGCACCAGCATCAGTAACCTCGAGGTTACTGATGCTGGTGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-194s21c1
Sequence:CCGGCTATCATCCAGCAGCTATATCCTCGAGGATATAGCTGCTGGATGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175133
GUCD1 MISSION shRNA Lentiviral Transduction Particles
guanylyl cyclase domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-714s21c1
Sequence:CCGGTACCGGCTGCATCTTCTATAACTCGAGTTATAGAAGATGCAGCCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-687s21c1
Sequence:CCGGCATCGTCCTGCGTGGCTATAACTCGAGTTATAGCCACGCAGGACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175133.1-2153s21c1
Sequence:CCGGCAAGTCCAGTCACCCATATTACTCGAGTAATATGGGTGACTGGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-760s21c1
Sequence:CCGGTGCAGCACCAGCATCAGTAACCTCGAGGTTACTGATGCTGGTGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175133.1-194s21c1
Sequence:CCGGCTATCATCCAGCAGCTATATCCTCGAGGATATAGCTGCTGGATGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371459
GUCD1 MISSION shRNA Bacterial Glycerol Stock
guanylyl cyclase domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371459.2-624s1c1
Sequence:CCGGGTAACTTTGAGGAGGCCAGAACTCGAGTTCTGGCCTCCTCAAAGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371459.2-2426s1c1
Sequence:CCGGCCATTGCTTTGGAGCACAGATCTCGAGATCTGTGCTCCAAAGCAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371459.2-1231s1c1
Sequence:CCGGCCAAGTTTCTGTGGCTCATTACTCGAGTAATGAGCCACAGAAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371459.2-352s1c1
Sequence:CCGGGAAATGCACAGTGAGTGTGAACTCGAGTTCACACTCACTGTGCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371459.2-116s1c1
Sequence:CCGGGACGACAGTGAGTTTGAGAGACTCGAGTCTCTCAAACTCACTGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371459.2-649s1c1
Sequence:CCGGCTATGGCACAGATGAGGACATCTCGAGATGTCCTCATCTGTGCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371459.2-259s1c1
Sequence:CCGGGAACCAGTCCTTCTACAGGAACTCGAGTTCCTGTAGAAGGACTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371459.2-2899s1c1
Sequence:CCGGCCACAAGTTAAAGGTCACCTTCTCGAGAAGGTGACCTTTAACTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371459
GUCD1 MISSION shRNA shRNA Plasmid DNA
guanylyl cyclase domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371459.2-624s1c1
Sequence:CCGGGTAACTTTGAGGAGGCCAGAACTCGAGTTCTGGCCTCCTCAAAGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371459.2-2426s1c1
Sequence:CCGGCCATTGCTTTGGAGCACAGATCTCGAGATCTGTGCTCCAAAGCAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371459.2-1231s1c1
Sequence:CCGGCCAAGTTTCTGTGGCTCATTACTCGAGTAATGAGCCACAGAAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371459.2-352s1c1
Sequence:CCGGGAAATGCACAGTGAGTGTGAACTCGAGTTCACACTCACTGTGCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371459.2-116s1c1
Sequence:CCGGGACGACAGTGAGTTTGAGAGACTCGAGTCTCTCAAACTCACTGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371459.2-649s1c1
Sequence:CCGGCTATGGCACAGATGAGGACATCTCGAGATGTCCTCATCTGTGCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371459.2-259s1c1
Sequence:CCGGGAACCAGTCCTTCTACAGGAACTCGAGTTCCTGTAGAAGGACTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371459.2-2899s1c1
Sequence:CCGGCCACAAGTTAAAGGTCACCTTCTCGAGAAGGTGACCTTTAACTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371459
GUCD1 MISSION shRNA Lentiviral Transduction Particles
guanylyl cyclase domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371459.2-624s1c1
Sequence:CCGGGTAACTTTGAGGAGGCCAGAACTCGAGTTCTGGCCTCCTCAAAGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371459.2-2426s1c1
Sequence:CCGGCCATTGCTTTGGAGCACAGATCTCGAGATCTGTGCTCCAAAGCAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371459.2-1231s1c1
Sequence:CCGGCCAAGTTTCTGTGGCTCATTACTCGAGTAATGAGCCACAGAAACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371459.2-352s1c1
Sequence:CCGGGAAATGCACAGTGAGTGTGAACTCGAGTTCACACTCACTGTGCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371459.2-116s1c1
Sequence:CCGGGACGACAGTGAGTTTGAGAGACTCGAGTCTCTCAAACTCACTGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_371459.2-649s1c1
Sequence:CCGGCTATGGCACAGATGAGGACATCTCGAGATGTCCTCATCTGTGCCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371459.2-259s1c1
Sequence:CCGGGAACCAGTCCTTCTACAGGAACTCGAGTTCCTGTAGAAGGACTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371459.2-2899s1c1
Sequence:CCGGCCACAAGTTAAAGGTCACCTTCTCGAGAAGGTGACCTTTAACTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)