EMAIL THIS PAGE TO A FRIEND

GUCY1A2

guanylate cyclase 1, soluble, alpha 2

96 Gene Product Result for
Synonyms: GC-SA2 GUC1A2
UniProtKB ID: P33402, A1L4C4
Gene ID:
Human(2977) Summary: Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(234889) guanylate cyclase 1, soluble, alpha 2
Rat(66012) guanylate cyclase 1, soluble, alpha 2
domestic guinea pig(100732121) guanylate cyclase 1, soluble, alpha 2
naked mole-rat(101702803) guanylate cyclase 1, soluble, alpha 2
sheep(101104339) guanylate cyclase 1, soluble, alpha 2
sheep(100294640) guanylate cyclase 1, soluble, alpha 2
chicken(771678) guanylate cyclase 1, soluble, alpha 2
domestic cat(101099494) guanylate cyclase 1, soluble, alpha 2
cow(613600) guanylate cyclase 1, soluble, alpha 2
dog(479455) guanylate cyclase 1, soluble, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N211 NS 2028 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000855 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033322 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033322 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033322 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081191 MISSION® esiRNA esiRNA human GUCY1A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000855 Rosetta Predictions human pricing
NM_023956 Rosetta Predictions rat pricing
XM_579478 Rosetta Predictions rat pricing
NM_001033322 Rosetta Predictions mouse pricing
XM_923534 Rosetta Predictions mouse pricing
XM_972907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303369 predicted 1885
2 SASI_Hs01_00226045 predicted 1978
3 SASI_Hs01_00226046 predicted 1219
4 SASI_Hs01_00226047 predicted 2540
5 SASI_Hs01_00226049 predicted 1849
6 SASI_Hs01_00226050 predicted 1237
7 SASI_Hs02_00303370 predicted 1543
8 SASI_Hs01_00226051 predicted 990
9 SASI_Hs01_00226052 predicted 1210
10 SASI_Hs01_00226053 predicted 862
11 SASI_Hs01_00226048 predicted 999
12 SASI_Hs01_00226054 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086148 predicted 1412
2 SASI_Rn01_00086149 predicted 1605
3 SASI_Rn02_00263761 predicted 1178
4 SASI_Rn02_00263762 predicted 1020
5 SASI_Rn01_00086151 predicted 1742
6 SASI_Rn02_00263763 predicted 741
7 SASI_Rn01_00086152 predicted 2389
8 SASI_Rn01_00086153 predicted 2001
9 SASI_Rn01_00086154 predicted 1189
10 SASI_Rn01_00086155 predicted 761
11 SASI_Rn01_00086150 predicted 741
12 SASI_Rn01_00086156 predicted 844
13 SASI_Rn01_00086157 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408566 predicted 793
2 SASI_Rn02_00408567 predicted 907
3 SASI_Rn02_00408568 predicted 903
4 SASI_Rn02_00408569 predicted 252
5 SASI_Rn02_00408570 predicted 260
6 SASI_Rn02_00408571 predicted 868
7 SASI_Rn02_00408572 predicted 254
8 SASI_Rn02_00408573 predicted 831
9 SASI_Rn02_00408574 predicted 899
10 SASI_Rn02_00408575 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288552 predicted 2320
2 SASI_Mm02_00288553 predicted 2603
3 SASI_Mm02_00288554 predicted 758
4 SASI_Mm02_00288555 predicted 1331
5 SASI_Mm02_00288556 predicted 1090
6 SASI_Mm02_00288557 predicted 784
7 SASI_Mm02_00288558 predicted 1038
8 SASI_Mm02_00288559 predicted 1293
9 SASI_Mm02_00288560 predicted 1571
10 SASI_Mm02_00288561 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_923534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238086 predicted 794
2 SASI_Mm01_00238087 predicted 402
3 SASI_Mm01_00238088 predicted 347
4 SASI_Mm01_00238089 predicted 908
5 SASI_Mm01_00238090 predicted 677
6 SASI_Mm01_00238091 predicted 356
7 SASI_Mm01_00238092 predicted 626
8 SASI_Mm01_00238093 predicted 872
9 SASI_Mm01_00238094 predicted 1162
10 SASI_Mm01_00238095 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_972907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240469 predicted 1900
2 SASI_Mm01_00240470 predicted 2182
3 SASI_Mm01_00240471 predicted 2098
4 SASI_Mm01_00240472 predicted 344
5 SASI_Mm01_00240473 predicted 907
6 SASI_Mm01_00240474 predicted 671
7 SASI_Mm01_00240475 predicted 873
8 SASI_Mm01_00240476 predicted 1155
9 SASI_Mm01_00240477 predicted 353
10 SASI_Mm01_00240478 predicted 1972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000855
GUCY1A2 MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 1, soluble, alpha 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-2274s21c1
Sequence:CCGGGGTGCGAATGCCACGTTATTGCTCGAGCAATAACGTGGCATTCGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-854s21c1
Sequence:CCGGTTCAGTGTACTGCTAATATACCTCGAGGTATATTAGCAGTACACTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-1889s21c1
Sequence:CCGGGTGATGTAGCCCAGCAATTATCTCGAGATAATTGCTGGGCTACATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-1998s21c1
Sequence:CCGGGTGTACTCCCATGCAAGTAATCTCGAGATTACTTGCATGGGAGTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-2368s1c1
Sequence:CCGGCCAACCACTTACCAATTATTACTCGAGTAATAATTGGTAAGTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000855.1-2710s1c1
Sequence:CCGGCTGTATTATGTCAGGCAATAACTCGAGTTATTGCCTGACATAATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-1495s1c1
Sequence:CCGGCCAAAGGTTAATGCCACCTTTCTCGAGAAAGGTGGCATTAACCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-1251s1c1
Sequence:CCGGCTGTCTTACTTTCCTTATCAACTCGAGTTGATAAGGAAAGTAAGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-2437s1c1
Sequence:CCGGCCAGACAACTTTCCAAAGGAACTCGAGTTCCTTTGGAAAGTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000855
GUCY1A2 MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 1, soluble, alpha 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-2274s21c1
Sequence:CCGGGGTGCGAATGCCACGTTATTGCTCGAGCAATAACGTGGCATTCGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-854s21c1
Sequence:CCGGTTCAGTGTACTGCTAATATACCTCGAGGTATATTAGCAGTACACTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-1889s21c1
Sequence:CCGGGTGATGTAGCCCAGCAATTATCTCGAGATAATTGCTGGGCTACATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-1998s21c1
Sequence:CCGGGTGTACTCCCATGCAAGTAATCTCGAGATTACTTGCATGGGAGTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-2368s1c1
Sequence:CCGGCCAACCACTTACCAATTATTACTCGAGTAATAATTGGTAAGTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000855.1-2710s1c1
Sequence:CCGGCTGTATTATGTCAGGCAATAACTCGAGTTATTGCCTGACATAATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-1495s1c1
Sequence:CCGGCCAAAGGTTAATGCCACCTTTCTCGAGAAAGGTGGCATTAACCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-1251s1c1
Sequence:CCGGCTGTCTTACTTTCCTTATCAACTCGAGTTGATAAGGAAAGTAAGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-2437s1c1
Sequence:CCGGCCAGACAACTTTCCAAAGGAACTCGAGTTCCTTTGGAAAGTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000855
GUCY1A2 MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 1, soluble, alpha 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-2274s21c1
Sequence:CCGGGGTGCGAATGCCACGTTATTGCTCGAGCAATAACGTGGCATTCGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-854s21c1
Sequence:CCGGTTCAGTGTACTGCTAATATACCTCGAGGTATATTAGCAGTACACTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-1889s21c1
Sequence:CCGGGTGATGTAGCCCAGCAATTATCTCGAGATAATTGCTGGGCTACATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000855.1-1998s21c1
Sequence:CCGGGTGTACTCCCATGCAAGTAATCTCGAGATTACTTGCATGGGAGTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-2368s1c1
Sequence:CCGGCCAACCACTTACCAATTATTACTCGAGTAATAATTGGTAAGTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000855.1-2710s1c1
Sequence:CCGGCTGTATTATGTCAGGCAATAACTCGAGTTATTGCCTGACATAATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-1495s1c1
Sequence:CCGGCCAAAGGTTAATGCCACCTTTCTCGAGAAAGGTGGCATTAACCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-1251s1c1
Sequence:CCGGCTGTCTTACTTTCCTTATCAACTCGAGTTGATAAGGAAAGTAAGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000855.1-2437s1c1
Sequence:CCGGCCAGACAACTTTCCAAAGGAACTCGAGTTCCTTTGGAAAGTTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033322
GUCY1A2 MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 1, soluble, alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033322.1-4325s21c1
Sequence:CCGGGTATTCTCACCCTGGTATAATCTCGAGATTATACCAGGGTGAGAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-1216s21c1
Sequence:CCGGGAAAGAGAATCTATCACTTAACTCGAGTTAAGTGATAGATTCTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-1537s21c1
Sequence:CCGGAGATCGTCTCTCCAATGATTACTCGAGTAATCATTGGAGAGACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-2327s21c1
Sequence:CCGGAGTACGAATGCCACGATATTGCTCGAGCAATATCGTGGCATTCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-1479s21c1
Sequence:CCGGCTACGGAAACAACTTCGATATCTCGAGATATCGAAGTTGTTTCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033322
GUCY1A2 MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 1, soluble, alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033322.1-4325s21c1
Sequence:CCGGGTATTCTCACCCTGGTATAATCTCGAGATTATACCAGGGTGAGAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-1216s21c1
Sequence:CCGGGAAAGAGAATCTATCACTTAACTCGAGTTAAGTGATAGATTCTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-1537s21c1
Sequence:CCGGAGATCGTCTCTCCAATGATTACTCGAGTAATCATTGGAGAGACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-2327s21c1
Sequence:CCGGAGTACGAATGCCACGATATTGCTCGAGCAATATCGTGGCATTCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-1479s21c1
Sequence:CCGGCTACGGAAACAACTTCGATATCTCGAGATATCGAAGTTGTTTCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033322
GUCY1A2 MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 1, soluble, alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033322.1-4325s21c1
Sequence:CCGGGTATTCTCACCCTGGTATAATCTCGAGATTATACCAGGGTGAGAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-1216s21c1
Sequence:CCGGGAAAGAGAATCTATCACTTAACTCGAGTTAAGTGATAGATTCTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-1537s21c1
Sequence:CCGGAGATCGTCTCTCCAATGATTACTCGAGTAATCATTGGAGAGACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-2327s21c1
Sequence:CCGGAGTACGAATGCCACGATATTGCTCGAGCAATATCGTGGCATTCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033322.1-1479s21c1
Sequence:CCGGCTACGGAAACAACTTCGATATCTCGAGATATCGAAGTTGTTTCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)