EMAIL THIS PAGE TO A FRIEND

GUCY1A3

guanylate cyclase 1, soluble, alpha 3

79 Gene Product Result for
Synonyms: GC-SA3 GUC1A3 GUCA3 GUCSA3 GUCY1A1
UniProtKB ID: Q02108, D3DP19, D6RDW3, O43843, Q8TAH3
Gene ID:
Human(2982) Summary: Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(60596) guanylate cyclase 1, soluble, alpha 3
Rat(497757) guanylate cyclase 1, soluble, alpha 3
Zebrafish(550420) guanylate cyclase 1, soluble, alpha 3
domestic cat(101098377) guanylate cyclase 1, soluble, alpha 3
cow(281216) guanylate cyclase 1, soluble, alpha 3
Horse(100069573) guanylate cyclase 1, soluble, alpha 3
dog(482663) guanylate cyclase 1, soluble, alpha 3
chicken(422407) guanylate cyclase 1, soluble, alpha 3
sheep(100294641) guanylate cyclase 1, soluble, alpha 3
domestic guinea pig(100728275) guanylate cyclase 1, soluble, alpha 3
naked mole-rat(101712487) guanylate cyclase 1, soluble, alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N211 NS 2028 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000856 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000856 Rosetta Predictions human pricing
NM_017090 Rosetta Predictions rat pricing
XM_579393 Rosetta Predictions rat pricing
NM_021896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185289 predicted 1455
2 SASI_Hs01_00185290 predicted 906
3 SASI_Hs02_00303371 predicted 2445
4 SASI_Hs01_00185291 predicted 1350
5 SASI_Hs01_00185292 predicted 1935
6 SASI_Hs01_00185293 predicted 1341
7 SASI_Hs02_00303372 predicted 2090
8 SASI_Hs01_00185294 predicted 564
9 SASI_Hs01_00185295 predicted 2491
10 SASI_Hs02_00303373 predicted 778
11 SASI_Hs01_00185288 predicted 2387
12 SASI_Hs01_00185296 predicted 1623
13 SASI_Hs01_00185297 predicted 2146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120475 predicted 2056
2 SASI_Rn01_00120477 predicted 1910
3 SASI_Rn01_00120478 predicted 1484
4 SASI_Rn02_00261304 predicted 378
5 SASI_Rn01_00120479 predicted 2086
6 SASI_Rn01_00120480 predicted 963
7 SASI_Rn01_00120481 predicted 2112
8 SASI_Rn01_00120482 predicted 1142
9 SASI_Rn01_00120483 predicted 1126
10 SASI_Rn02_00261305 predicted 741
11 SASI_Rn01_00120476 predicted 1528
12 SASI_Rn01_00120484 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127319 predicted 1315
2 SASI_Rn01_00127320 predicted 1377
3 SASI_Rn01_00127321 predicted 1257
4 SASI_Rn01_00127322 predicted 1405
5 SASI_Rn01_00127323 predicted 1404
6 SASI_Rn01_00127324 predicted 1242
7 SASI_Rn01_00127325 predicted 1344
8 SASI_Rn01_00127326 predicted 1415
9 SASI_Rn01_00127327 predicted 1411
10 SASI_Rn01_00127328 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068336 predicted 485
2 SASI_Mm01_00068337 predicted 1099
3 SASI_Mm01_00068338 predicted 1360
4 SASI_Mm01_00068339 predicted 649
5 SASI_Mm01_00068340 predicted 1115
6 SASI_Mm01_00068341 predicted 627
7 SASI_Mm01_00068342 predicted 1110
8 SASI_Mm01_00068343 predicted 2285
9 SASI_Mm01_00068344 predicted 641
10 SASI_Mm02_00326463 predicted 1449
11 SASI_Mm01_00068335 predicted 2294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000856
VALIDATED
GUCY1A3 MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 1, soluble, alpha 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000856.1-2218s1c1
Sequence:CCGGGAACCTATCAAGATGCGAATTCTCGAGAATTCGCATCTTGATAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_000856.1-722s1c1
Sequence:CCGGGCCGAGTCTATCTTCACACTTCTCGAGAAGTGTGAAGATAGACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000856.1-1202s1c1
Sequence:CCGGCGGAAGTGGAAGTGTCGTTAACTCGAGTTAACGACACTTCCACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000856.1-1079s1c1
Sequence:CCGGCCTCCATTCTATGCCTGGATACTCGAGTATCCAGGCATAGAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_000856.1-673s1c1
Sequence:CCGGCCTGAGAAGAACATACAAGAACTCGAGTTCTTGTATGTTCTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000856
VALIDATED
GUCY1A3 MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 1, soluble, alpha 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000856.1-2218s1c1
Sequence:CCGGGAACCTATCAAGATGCGAATTCTCGAGAATTCGCATCTTGATAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_000856.1-722s1c1
Sequence:CCGGGCCGAGTCTATCTTCACACTTCTCGAGAAGTGTGAAGATAGACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000856.1-1202s1c1
Sequence:CCGGCGGAAGTGGAAGTGTCGTTAACTCGAGTTAACGACACTTCCACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000856.1-1079s1c1
Sequence:CCGGCCTCCATTCTATGCCTGGATACTCGAGTATCCAGGCATAGAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_000856.1-673s1c1
Sequence:CCGGCCTGAGAAGAACATACAAGAACTCGAGTTCTTGTATGTTCTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000856
VALIDATED
GUCY1A3 MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 1, soluble, alpha 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000856.1-2218s1c1
Sequence:CCGGGAACCTATCAAGATGCGAATTCTCGAGAATTCGCATCTTGATAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_000856.1-722s1c1
Sequence:CCGGGCCGAGTCTATCTTCACACTTCTCGAGAAGTGTGAAGATAGACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000856.1-1202s1c1
Sequence:CCGGCGGAAGTGGAAGTGTCGTTAACTCGAGTTAACGACACTTCCACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000856.1-1079s1c1
Sequence:CCGGCCTCCATTCTATGCCTGGATACTCGAGTATCCAGGCATAGAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_000856.1-673s1c1
Sequence:CCGGCCTGAGAAGAACATACAAGAACTCGAGTTCTTGTATGTTCTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021896
GUCY1A3 MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 1, soluble, alpha 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-808s1c1
Sequence:CCGGCCAGGACTTTCTAAATGTTTACTCGAGTAAACATTTAGAAAGTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021896.5-1400s21c1
Sequence:CCGGATGGATCTCAAAGGTCAAATGCTCGAGCATTTGACCTTTGAGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-2080s1c1
Sequence:CCGGCACCACATACAGGTTACTCAACTCGAGTTGAGTAACCTGTATGTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-971s1c1
Sequence:CCGGCCCTATTTGCTCTACTCCGTTCTCGAGAACGGAGTAGAGCAAATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-1216s1c1
Sequence:CCGGCCAGACATTTAGTGGCATCATCTCGAGATGATGCCACTAAATGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-2274s1c1
Sequence:CCGGGCAAAGCGTCAGGGATAGATTCTCGAGAATCTATCCCTGACGCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021896.5-2289s21c1
Sequence:CCGGATCACCATCAAGGACCTAATTCTCGAGAATTAGGTCCTTGATGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021896.5-948s21c1
Sequence:CCGGTGCTTCTCCCTGGTATCATTACTCGAGTAATGATACCAGGGAGAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021896
GUCY1A3 MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 1, soluble, alpha 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-808s1c1
Sequence:CCGGCCAGGACTTTCTAAATGTTTACTCGAGTAAACATTTAGAAAGTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021896.5-1400s21c1
Sequence:CCGGATGGATCTCAAAGGTCAAATGCTCGAGCATTTGACCTTTGAGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-2080s1c1
Sequence:CCGGCACCACATACAGGTTACTCAACTCGAGTTGAGTAACCTGTATGTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-971s1c1
Sequence:CCGGCCCTATTTGCTCTACTCCGTTCTCGAGAACGGAGTAGAGCAAATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-1216s1c1
Sequence:CCGGCCAGACATTTAGTGGCATCATCTCGAGATGATGCCACTAAATGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-2274s1c1
Sequence:CCGGGCAAAGCGTCAGGGATAGATTCTCGAGAATCTATCCCTGACGCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021896.5-2289s21c1
Sequence:CCGGATCACCATCAAGGACCTAATTCTCGAGAATTAGGTCCTTGATGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021896.5-948s21c1
Sequence:CCGGTGCTTCTCCCTGGTATCATTACTCGAGTAATGATACCAGGGAGAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021896
GUCY1A3 MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 1, soluble, alpha 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-808s1c1
Sequence:CCGGCCAGGACTTTCTAAATGTTTACTCGAGTAAACATTTAGAAAGTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021896.5-1400s21c1
Sequence:CCGGATGGATCTCAAAGGTCAAATGCTCGAGCATTTGACCTTTGAGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-2080s1c1
Sequence:CCGGCACCACATACAGGTTACTCAACTCGAGTTGAGTAACCTGTATGTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-971s1c1
Sequence:CCGGCCCTATTTGCTCTACTCCGTTCTCGAGAACGGAGTAGAGCAAATAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-1216s1c1
Sequence:CCGGCCAGACATTTAGTGGCATCATCTCGAGATGATGCCACTAAATGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021896.3-2274s1c1
Sequence:CCGGGCAAAGCGTCAGGGATAGATTCTCGAGAATCTATCCCTGACGCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021896.5-2289s21c1
Sequence:CCGGATCACCATCAAGGACCTAATTCTCGAGAATTAGGTCCTTGATGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021896.5-948s21c1
Sequence:CCGGTGCTTCTCCCTGGTATCATTACTCGAGTAATGATACCAGGGAGAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)