EMAIL THIS PAGE TO A FRIEND

GUCY1B2

guanylate cyclase 1, soluble, beta 2 (pseudogene)

58 Gene Product Result for
Synonyms: GC-SB2
UniProtKB ID: O75343, Q9NZ64
Gene ID:
Mouse(239134) guanylate cyclase 1, soluble, beta 2
Rat(25206) guanylate cyclase 1, soluble, beta 2
chicken(429128) guanylate cyclase 1, soluble, beta 2 (pseudogene)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N211 NS 2028 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004129 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004129 Rosetta Predictions human pricing
NR_003923 Rosetta Predictions human pricing
NM_012770 Rosetta Predictions rat pricing
NM_172810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197121 predicted 993
2 SASI_Hs01_00197122 predicted 1633
3 SASI_Hs01_00197123 predicted 1461
4 SASI_Hs01_00197124 predicted 474
5 SASI_Hs01_00197125 predicted 438
6 SASI_Hs01_00197126 predicted 723
7 SASI_Hs01_00197127 predicted 1088
8 SASI_Hs01_00197128 predicted 1944
9 SASI_Hs01_00197129 predicted 1835
10 SASI_Hs01_00197130 predicted 1755
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380521 predicted 1625
2 SASI_Hs02_00380522 predicted 2236
3 SASI_Hs02_00380523 predicted 2306
4 SASI_Hs02_00380524 predicted 2505
5 SASI_Hs02_00380525 predicted 1084
6 SASI_Hs02_00380526 predicted 1940
7 SASI_Hs02_00380527 predicted 1830
8 SASI_Hs02_00380528 predicted 2044
9 SASI_Hs02_00380529 predicted 2467
10 SASI_Hs02_00380530 predicted 2362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083381 predicted 378
2 SASI_Rn01_00083382 predicted 866
3 SASI_Rn01_00083383 predicted 1688
4 SASI_Rn01_00083384 predicted 1561
5 SASI_Rn01_00083385 predicted 1863
6 SASI_Rn01_00083386 predicted 2057
7 SASI_Rn01_00083387 predicted 1467
8 SASI_Rn01_00083389 predicted 430
9 SASI_Rn01_00083390 predicted 1667
10 SASI_Rn02_00260146 predicted 1950
11 SASI_Rn01_00083388 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344733 predicted 1390
2 SASI_Mm01_00075121 predicted 1922
3 SASI_Mm01_00075122 predicted 1764
4 SASI_Mm01_00075123 predicted 2182
5 SASI_Mm01_00075124 predicted 794
6 SASI_Mm01_00075125 predicted 1604
7 SASI_Mm01_00075127 predicted 1811
8 SASI_Mm02_00344734 predicted 396
9 SASI_Mm01_00075129 predicted 2424
10 SASI_Mm02_00344735 predicted 1831
11 SASI_Mm01_00075126 predicted 2048
12 SASI_Mm01_00075128 predicted 1126
13 SASI_Mm01_00075130 predicted 1749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172810
GUCY1B2 MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 1, soluble, beta 2 (pseudogene)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-1811s1c1
Sequence:CCGGGCTCAACTCAATGTACTCCAACTCGAGTTGGAGTACATTGAGTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-1277s1c1
Sequence:CCGGCCCTCAAGTTACTTTCAACATCTCGAGATGTTGAAAGTAACTTGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-362s1c1
Sequence:CCGGGCAGTCTCTTGTGACAGAGAACTCGAGTTCTCTGTCACAAGAGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-2421s1c1
Sequence:CCGGGCTTCTGATGAAGTCACACTTCTCGAGAAGTGTGACTTCATCAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-1928s1c1
Sequence:CCGGCCATGCTCAAAGAGTTGCTAACTCGAGTTAGCAACTCTTTGAGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-1243s21c1
Sequence:CCGGGTTTGGTCTAGATGAGTATTTCTCGAGAAATACTCATCTAGACCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-756s21c1
Sequence:CCGGACATCGTACCAGGCATCATTGCTCGAGCAATGATGCCTGGTACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-458s21c1
Sequence:CCGGGATGATACCATCACCGTTAAGCTCGAGCTTAACGGTGATGGTATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-328s21c1
Sequence:CCGGGGACACCATGTACGGATTTATCTCGAGATAAATCCGTACATGGTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172810
GUCY1B2 MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 1, soluble, beta 2 (pseudogene)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-1811s1c1
Sequence:CCGGGCTCAACTCAATGTACTCCAACTCGAGTTGGAGTACATTGAGTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-1277s1c1
Sequence:CCGGCCCTCAAGTTACTTTCAACATCTCGAGATGTTGAAAGTAACTTGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-362s1c1
Sequence:CCGGGCAGTCTCTTGTGACAGAGAACTCGAGTTCTCTGTCACAAGAGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-2421s1c1
Sequence:CCGGGCTTCTGATGAAGTCACACTTCTCGAGAAGTGTGACTTCATCAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-1928s1c1
Sequence:CCGGCCATGCTCAAAGAGTTGCTAACTCGAGTTAGCAACTCTTTGAGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-1243s21c1
Sequence:CCGGGTTTGGTCTAGATGAGTATTTCTCGAGAAATACTCATCTAGACCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-756s21c1
Sequence:CCGGACATCGTACCAGGCATCATTGCTCGAGCAATGATGCCTGGTACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-458s21c1
Sequence:CCGGGATGATACCATCACCGTTAAGCTCGAGCTTAACGGTGATGGTATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-328s21c1
Sequence:CCGGGGACACCATGTACGGATTTATCTCGAGATAAATCCGTACATGGTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172810
GUCY1B2 MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 1, soluble, beta 2 (pseudogene)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-1811s1c1
Sequence:CCGGGCTCAACTCAATGTACTCCAACTCGAGTTGGAGTACATTGAGTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-1277s1c1
Sequence:CCGGCCCTCAAGTTACTTTCAACATCTCGAGATGTTGAAAGTAACTTGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-362s1c1
Sequence:CCGGGCAGTCTCTTGTGACAGAGAACTCGAGTTCTCTGTCACAAGAGACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-2421s1c1
Sequence:CCGGGCTTCTGATGAAGTCACACTTCTCGAGAAGTGTGACTTCATCAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172810.1-1928s1c1
Sequence:CCGGCCATGCTCAAAGAGTTGCTAACTCGAGTTAGCAACTCTTTGAGCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-1243s21c1
Sequence:CCGGGTTTGGTCTAGATGAGTATTTCTCGAGAAATACTCATCTAGACCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-756s21c1
Sequence:CCGGACATCGTACCAGGCATCATTGCTCGAGCAATGATGCCTGGTACGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-458s21c1
Sequence:CCGGGATGATACCATCACCGTTAAGCTCGAGCTTAACGGTGATGGTATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172810.2-328s21c1
Sequence:CCGGGGACACCATGTACGGATTTATCTCGAGATAAATCCGTACATGGTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004129
GUCY1B2 MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 1, soluble, beta 2 (pseudogene)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000078393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-1022s1c1
Sequence:CCGGCGCAGATTTATCAACAGTCAACTCGAGTTGACTGTTGATAAATCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-1642s1c1
Sequence:CCGGCCATGCTCAAAGAGTGGCTAACTCGAGTTAGCCACTCTTTGAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-1465s1c1
Sequence:CCGGCGATGTAGTGACATTTACTAACTCGAGTTAGTAAATGTCACTACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-500s1c1
Sequence:CCGGGCCAAAGACTTCTTTGATATTCTCGAGAATATCAAAGAAGTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004129
GUCY1B2 MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 1, soluble, beta 2 (pseudogene)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000078393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-1022s1c1
Sequence:CCGGCGCAGATTTATCAACAGTCAACTCGAGTTGACTGTTGATAAATCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-1642s1c1
Sequence:CCGGCCATGCTCAAAGAGTGGCTAACTCGAGTTAGCCACTCTTTGAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-1465s1c1
Sequence:CCGGCGATGTAGTGACATTTACTAACTCGAGTTAGTAAATGTCACTACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-500s1c1
Sequence:CCGGGCCAAAGACTTCTTTGATATTCTCGAGAATATCAAAGAAGTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004129
GUCY1B2 MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 1, soluble, beta 2 (pseudogene)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000078393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-1022s1c1
Sequence:CCGGCGCAGATTTATCAACAGTCAACTCGAGTTGACTGTTGATAAATCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-1642s1c1
Sequence:CCGGCCATGCTCAAAGAGTGGCTAACTCGAGTTAGCCACTCTTTGAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-1465s1c1
Sequence:CCGGCGATGTAGTGACATTTACTAACTCGAGTTAGTAAATGTCACTACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004129.1-500s1c1
Sequence:CCGGGCCAAAGACTTCTTTGATATTCTCGAGAATATCAAAGAAGTCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)