EMAIL THIS PAGE TO A FRIEND

GUCY1B3

guanylate cyclase 1, soluble, beta 3

84 Gene Product Result for
Synonyms: GC-S-beta-1 GC-SB3 GUC1B3 GUCB3 GUCSB3 GUCY1B1
UniProtKB ID: Q02153, Q86WY5
Gene ID:
Human(2983) Summary: Soluble guanylate cyclase (sGC), a heterodimeric protein consisting of an alpha subunit and a beta subunit, typically GUCY1B3, catalyzes conversion of GTP to the second messenger cGMP and functions as the main receptor for nitric oxide (NO) and nitrovasodilator drugs (Zabel et al., 1998 [PubMed 9742212]
Mouse(54195) guanylate cyclase 1, soluble, beta 3
Rat(25202) guanylate cyclase 1, soluble, beta 3
Zebrafish(100150304) guanylate cyclase 1, soluble, beta 3
cow(282433) guanylate cyclase 1, soluble, beta 3
domestic cat(101089435) guanylate cyclase 1, soluble, beta 3
dog(553102) guanylate cyclase 1, soluble, beta 3
chicken(422408) guanylate cyclase 1, soluble, beta 3
domestic guinea pig(100723676) guanylate cyclase 1, soluble, beta 3
naked mole-rat(101724888) guanylate cyclase 1, soluble, beta 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N211 NS 2028 solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000857 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138061 MISSION® esiRNA esiRNA human GUCY1B3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000857 Rosetta Predictions human pricing
NM_012769 Rosetta Predictions rat pricing
NM_017469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057133 predicted 317
2 SASI_Hs01_00057134 predicted 1668
3 SASI_Hs01_00057135 predicted 708
4 SASI_Hs01_00057136 predicted 1874
5 SASI_Hs01_00057137 predicted 859
6 SASI_Hs01_00057138 predicted 1100
7 SASI_Hs02_00303374 predicted 1958
8 SASI_Hs01_00057141 predicted 251
9 SASI_Hs02_00303375 predicted 1186
10 SASI_Hs01_00057142 predicted 1594
11 SASI_Hs01_00057139 predicted 366
12 SASI_Hs01_00057140 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012769 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096353 predicted 1597
2 SASI_Rn01_00096354 predicted 1770
3 SASI_Rn01_00096355 predicted 705
4 SASI_Rn01_00096356 predicted 516
5 SASI_Rn01_00096357 predicted 1293
6 SASI_Rn01_00096358 predicted 288
7 SASI_Rn01_00096359 predicted 1407
8 SASI_Rn01_00096360 predicted 1062
9 SASI_Rn01_00096361 predicted 1702
10 SASI_Rn01_00096362 predicted 1565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080735 predicted 1617
2 SASI_Mm01_00080736 predicted 1791
3 SASI_Mm01_00080737 predicted 585
4 SASI_Mm01_00080738 predicted 574
5 SASI_Mm01_00080739 predicted 881
6 SASI_Mm01_00080741 predicted 1314
7 SASI_Mm01_00080742 predicted 1601
8 SASI_Mm01_00080743 predicted 274
9 SASI_Mm01_00080744 predicted 1200
10 SASI_Mm02_00323932 predicted 722
11 SASI_Mm01_00080740 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017469
GUCY1B3 MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 1, soluble, beta 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017469.4-396s21c1
Sequence:CCGGTTGCGTGTCCTGGGATCTAATCTCGAGATTAGATCCCAGGACACGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-1630s1c1
Sequence:CCGGGCTGGTCAAGTTCAAGTAGATCTCGAGATCTACTTGAACTTGACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-919s1c1
Sequence:CCGGTCACACATCAATACAGTCTTTCTCGAGAAAGACTGTATTGATGTGTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-1510s1c1
Sequence:CCGGCCATTTGTTTACAAGGTGGAACTCGAGTTCCACCTTGTAAACAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-215s1c1
Sequence:CCGGGCCAGTTTCTTGTCAGAATAACTCGAGTTATTCTGACAAGAAACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-1948s1c1
Sequence:CCGGGAAACAAATGAGGAGGATGAACTCGAGTTCATCCTCCTCATTTGTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017469.4-1489s21c1
Sequence:CCGGACGATCTCTACACCCGATTTGCTCGAGCAAATCGGGTGTAGAGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017469.4-2271s21c1
Sequence:CCGGTGCCTAGACGGACGTTCTAAACTCGAGTTTAGAACGTCCGTCTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017469
GUCY1B3 MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 1, soluble, beta 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017469.4-396s21c1
Sequence:CCGGTTGCGTGTCCTGGGATCTAATCTCGAGATTAGATCCCAGGACACGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-1630s1c1
Sequence:CCGGGCTGGTCAAGTTCAAGTAGATCTCGAGATCTACTTGAACTTGACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-919s1c1
Sequence:CCGGTCACACATCAATACAGTCTTTCTCGAGAAAGACTGTATTGATGTGTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-1510s1c1
Sequence:CCGGCCATTTGTTTACAAGGTGGAACTCGAGTTCCACCTTGTAAACAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-215s1c1
Sequence:CCGGGCCAGTTTCTTGTCAGAATAACTCGAGTTATTCTGACAAGAAACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-1948s1c1
Sequence:CCGGGAAACAAATGAGGAGGATGAACTCGAGTTCATCCTCCTCATTTGTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017469.4-1489s21c1
Sequence:CCGGACGATCTCTACACCCGATTTGCTCGAGCAAATCGGGTGTAGAGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017469.4-2271s21c1
Sequence:CCGGTGCCTAGACGGACGTTCTAAACTCGAGTTTAGAACGTCCGTCTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017469
GUCY1B3 MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 1, soluble, beta 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017469.4-396s21c1
Sequence:CCGGTTGCGTGTCCTGGGATCTAATCTCGAGATTAGATCCCAGGACACGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-1630s1c1
Sequence:CCGGGCTGGTCAAGTTCAAGTAGATCTCGAGATCTACTTGAACTTGACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-919s1c1
Sequence:CCGGTCACACATCAATACAGTCTTTCTCGAGAAAGACTGTATTGATGTGTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-1510s1c1
Sequence:CCGGCCATTTGTTTACAAGGTGGAACTCGAGTTCCACCTTGTAAACAAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-215s1c1
Sequence:CCGGGCCAGTTTCTTGTCAGAATAACTCGAGTTATTCTGACAAGAAACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017469.2-1948s1c1
Sequence:CCGGGAAACAAATGAGGAGGATGAACTCGAGTTCATCCTCCTCATTTGTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017469.4-1489s21c1
Sequence:CCGGACGATCTCTACACCCGATTTGCTCGAGCAAATCGGGTGTAGAGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017469.4-2271s21c1
Sequence:CCGGTGCCTAGACGGACGTTCTAAACTCGAGTTTAGAACGTCCGTCTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000857
VALIDATED
GUCY1B3 MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 1, soluble, beta 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000857.1-1877s1c1
Sequence:CCGGGAACCAATGCAAGTTTGGTTTCTCGAGAAACCAAACTTGCATTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000857.2-1665s21c1
Sequence:CCGGGCCTTGGACATGATGGAAATTCTCGAGAATTTCCATCATGTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000857.2-782s21c1
Sequence:CCGGATCACGCATCAGCCCATATACCTCGAGGTATATGGGCTGATGCGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000857.1-1586s1c1
Sequence:CCGGGCCTTGGACATGATGGAAATTCTCGAGAATTTCCATCATGTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000857.1-580s1c1
Sequence:CCGGGAAGGTTATTCAGCAAAGAAACTCGAGTTTCTTTGCTGAATAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000857.1-286s1c1
Sequence:CCGGCCTCCAAATGTTTGGGAAGATCTCGAGATCTTCCCAAACATTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000857.1-712s1c1
Sequence:CCGGCAGCCCATATACATTCTGCAACTCGAGTTGCAGAATGTATATGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000857.2-2169s21c1
Sequence:CCGGTATCTCTCACTATCCGTTATTCTCGAGAATAACGGATAGTGAGAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000857.2-659s21c1
Sequence:CCGGGAAGGTTATTCAGCAAAGAAACTCGAGTTTCTTTGCTGAATAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000857.2-1956s21c1
Sequence:CCGGGAACCAATGCAAGTTTGGTTTCTCGAGAAACCAAACTTGCATTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000857
VALIDATED
GUCY1B3 MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 1, soluble, beta 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000857.1-1877s1c1
Sequence:CCGGGAACCAATGCAAGTTTGGTTTCTCGAGAAACCAAACTTGCATTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000857.2-1665s21c1
Sequence:CCGGGCCTTGGACATGATGGAAATTCTCGAGAATTTCCATCATGTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000857.2-782s21c1
Sequence:CCGGATCACGCATCAGCCCATATACCTCGAGGTATATGGGCTGATGCGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000857.1-1586s1c1
Sequence:CCGGGCCTTGGACATGATGGAAATTCTCGAGAATTTCCATCATGTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000857.1-580s1c1
Sequence:CCGGGAAGGTTATTCAGCAAAGAAACTCGAGTTTCTTTGCTGAATAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000857.1-286s1c1
Sequence:CCGGCCTCCAAATGTTTGGGAAGATCTCGAGATCTTCCCAAACATTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000857.1-712s1c1
Sequence:CCGGCAGCCCATATACATTCTGCAACTCGAGTTGCAGAATGTATATGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000857.2-2169s21c1
Sequence:CCGGTATCTCTCACTATCCGTTATTCTCGAGAATAACGGATAGTGAGAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000857.2-659s21c1
Sequence:CCGGGAAGGTTATTCAGCAAAGAAACTCGAGTTTCTTTGCTGAATAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000857.2-1956s21c1
Sequence:CCGGGAACCAATGCAAGTTTGGTTTCTCGAGAAACCAAACTTGCATTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000857
VALIDATED
GUCY1B3 MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 1, soluble, beta 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000857.1-1877s1c1
Sequence:CCGGGAACCAATGCAAGTTTGGTTTCTCGAGAAACCAAACTTGCATTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000857.2-1665s21c1
Sequence:CCGGGCCTTGGACATGATGGAAATTCTCGAGAATTTCCATCATGTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000857.2-782s21c1
Sequence:CCGGATCACGCATCAGCCCATATACCTCGAGGTATATGGGCTGATGCGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000857.1-1586s1c1
Sequence:CCGGGCCTTGGACATGATGGAAATTCTCGAGAATTTCCATCATGTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000857.1-580s1c1
Sequence:CCGGGAAGGTTATTCAGCAAAGAAACTCGAGTTTCTTTGCTGAATAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_000857.1-286s1c1
Sequence:CCGGCCTCCAAATGTTTGGGAAGATCTCGAGATCTTCCCAAACATTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000857.1-712s1c1
Sequence:CCGGCAGCCCATATACATTCTGCAACTCGAGTTGCAGAATGTATATGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000857.2-2169s21c1
Sequence:CCGGTATCTCTCACTATCCGTTATTCTCGAGAATAACGGATAGTGAGAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000857.2-659s21c1
Sequence:CCGGGAAGGTTATTCAGCAAAGAAACTCGAGTTTCTTTGCTGAATAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_000857.2-1956s21c1
Sequence:CCGGGAACCAATGCAAGTTTGGTTTCTCGAGAAACCAAACTTGCATTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)