EMAIL THIS PAGE TO A FRIEND

GUCY2D

guanylate cyclase 2D, membrane (retina-specific)

71 Gene Product Result for
Synonyms: CORD5 CORD6 CYGD GUC1A4 GUC2D LCA LCA1 RCD2 RETGC-1 ROS-GC1 ROSGC retGC
UniProtKB ID: Q02846, Q6LEA7
Gene ID:
Human(3000) Summary: This gene encodes a retina-specific guanylate cyclase, which is a member of the membrane guanylyl cyclase family. Like other membrane guanylyl cyclases, this enzyme has a hydrophobic amino-terminal signal sequence followed by a large extracellular domain, a single membrane spanning domain, a kinase homology domain, and a guanylyl cyclase catalytic domain. In contrast to other membrane guanylyl cyclases, this enzyme is not activated by natriuretic peptides. Mutations in this gene result in Leber congenital amaurosis and cone-rod dystrophy-6 diseases. [provided by RefSeq, Dec 2008]
Mouse(14918) guanylate cyclase 2d
Rat(113911) guanylate cyclase 2d
dog(403863) guanylate cyclase 2D, membrane (retina-specific)
cow(282245) guanylate cyclase 2D, membrane (retina-specific)
sheep(101120932) guanylate cyclase 2D, membrane (retina-specific)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001130693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001130693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001130693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU195091 MISSION® esiRNA esiRNA targeting mouse Gucy2d mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000180 Rosetta Predictions human pricing
NM_130737 Rosetta Predictions rat pricing
NM_001130693 Rosetta Predictions mouse pricing
XM_001472460 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091275 predicted 1105
2 SASI_Hs01_00091276 predicted 2249
3 SASI_Hs01_00091277 predicted 795
4 SASI_Hs01_00091278 predicted 2948
5 SASI_Hs01_00091279 predicted 2015
6 SASI_Hs01_00091280 predicted 2553
7 SASI_Hs01_00091281 predicted 3368
8 SASI_Hs01_00091282 predicted 2563
9 SASI_Hs02_00302021 predicted 2951
10 SASI_Hs01_00091284 predicted 1114
11 SASI_Hs01_00091283 predicted 2701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089107 predicted 2044
2 SASI_Rn01_00089108 predicted 2016
3 SASI_Rn01_00089109 predicted 2858
4 SASI_Rn01_00089110 predicted 3035
5 SASI_Rn02_00267467 predicted 1937
6 SASI_Rn01_00089111 predicted 999
7 SASI_Rn01_00089114 predicted 1722
8 SASI_Rn02_00267468 predicted 1574
9 SASI_Rn02_00267469 predicted 2893
10 SASI_Rn01_00089116 predicted 2528
11 SASI_Rn01_00089112 predicted 485
12 SASI_Rn01_00089113 predicted 2183
13 SASI_Rn01_00089115 predicted 2536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311400 predicted 2077
2 SASI_Mm02_00311401 predicted 2705
3 SASI_Mm02_00311402 predicted 1292
4 SASI_Mm02_00311403 predicted 2092
5 SASI_Mm02_00311404 predicted 1918
6 SASI_Mm02_00311405 predicted 522
7 SASI_Mm02_00311406 predicted 2277
8 SASI_Mm02_00311407 predicted 377
9 SASI_Mm02_00311408 predicted 1172
10 SASI_Mm02_00311409 predicted 2412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472460 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00361630 predicted 2077
2 SASI_Mm02_00361631 predicted 2720
3 SASI_Mm02_00361632 predicted 1290
4 SASI_Mm02_00361633 predicted 2084
5 SASI_Mm02_00361634 predicted 1916
6 SASI_Mm02_00361635 predicted 520
7 SASI_Mm02_00361636 predicted 2284
8 SASI_Mm02_00361637 predicted 377
9 SASI_Mm02_00361638 predicted 1171
10 SASI_Mm02_00361639 predicted 2425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000180
GUCY2D MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 2D, membrane (retina-specific)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-1539s1c1
Sequence:CCGGACCGGCTACTTCACATGCAAACTCGAGTTTGCATGTGAAGTAGCCGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-2506s1c1
Sequence:CCGGCCGGAAGACGAACATCATTGACTCGAGTCAATGATGTTCGTCTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-2788s1c1
Sequence:CCGGCAACGATCTCTACACACTCTTCTCGAGAAGAGTGTGTAGAGATCGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000180.x-3594s1c1
Sequence:CCGGGGTGGGTGAAATAAAGGCATACTCGAGTATGCCTTTATTTCACCCACCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-2257s1c1
Sequence:CCGGCGTCTTTAGCTTGGCCATCATCTCGAGATGATGGCCAAGCTAAAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000180.1-3418s1c1
Sequence:CCGGCCCTGCTCCCTGTCCCATCTGCTCGAGCAGATGGGACAGGGAGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-3116s1c1
Sequence:CCGGCCTTACCGCATCCACGTGAACCTCGAGGTTCACGTGGATGCGGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2096s1c1
Sequence:CCGGGATGGCAGATTCGTACTCAAGCTCGAGCTTGAGTACGAATCTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2712s1c1
Sequence:CCGGCACTGTACTTTAGTGACATTGCTCGAGCAATGTCACTAAAGTACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2014s1c1
Sequence:CCGGGCTGGACCTTATCAAGGGAATCTCGAGATTCCCTTGATAAGGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000180.1-3427s1c1
Sequence:CCGGCTGTCCCATCTGCAGTGGACCCTCGAGGGTCCACTGCAGATGGGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2815s1c1
Sequence:CCGGCATCATTGGTTCCCACGATGTCTCGAGACATCGTGGGAACCAATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000180
GUCY2D MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 2D, membrane (retina-specific)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-1539s1c1
Sequence:CCGGACCGGCTACTTCACATGCAAACTCGAGTTTGCATGTGAAGTAGCCGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-2506s1c1
Sequence:CCGGCCGGAAGACGAACATCATTGACTCGAGTCAATGATGTTCGTCTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-2788s1c1
Sequence:CCGGCAACGATCTCTACACACTCTTCTCGAGAAGAGTGTGTAGAGATCGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000180.x-3594s1c1
Sequence:CCGGGGTGGGTGAAATAAAGGCATACTCGAGTATGCCTTTATTTCACCCACCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-2257s1c1
Sequence:CCGGCGTCTTTAGCTTGGCCATCATCTCGAGATGATGGCCAAGCTAAAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000180.1-3418s1c1
Sequence:CCGGCCCTGCTCCCTGTCCCATCTGCTCGAGCAGATGGGACAGGGAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-3116s1c1
Sequence:CCGGCCTTACCGCATCCACGTGAACCTCGAGGTTCACGTGGATGCGGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2096s1c1
Sequence:CCGGGATGGCAGATTCGTACTCAAGCTCGAGCTTGAGTACGAATCTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2712s1c1
Sequence:CCGGCACTGTACTTTAGTGACATTGCTCGAGCAATGTCACTAAAGTACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2014s1c1
Sequence:CCGGGCTGGACCTTATCAAGGGAATCTCGAGATTCCCTTGATAAGGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000180.1-3427s1c1
Sequence:CCGGCTGTCCCATCTGCAGTGGACCCTCGAGGGTCCACTGCAGATGGGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2815s1c1
Sequence:CCGGCATCATTGGTTCCCACGATGTCTCGAGACATCGTGGGAACCAATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000180
GUCY2D MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 2D, membrane (retina-specific)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-1539s1c1
Sequence:CCGGACCGGCTACTTCACATGCAAACTCGAGTTTGCATGTGAAGTAGCCGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-2506s1c1
Sequence:CCGGCCGGAAGACGAACATCATTGACTCGAGTCAATGATGTTCGTCTTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-2788s1c1
Sequence:CCGGCAACGATCTCTACACACTCTTCTCGAGAAGAGTGTGTAGAGATCGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000180.x-3594s1c1
Sequence:CCGGGGTGGGTGAAATAAAGGCATACTCGAGTATGCCTTTATTTCACCCACCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.x-2257s1c1
Sequence:CCGGCGTCTTTAGCTTGGCCATCATCTCGAGATGATGGCCAAGCTAAAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000180.1-3418s1c1
Sequence:CCGGCCCTGCTCCCTGTCCCATCTGCTCGAGCAGATGGGACAGGGAGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-3116s1c1
Sequence:CCGGCCTTACCGCATCCACGTGAACCTCGAGGTTCACGTGGATGCGGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2096s1c1
Sequence:CCGGGATGGCAGATTCGTACTCAAGCTCGAGCTTGAGTACGAATCTGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2712s1c1
Sequence:CCGGCACTGTACTTTAGTGACATTGCTCGAGCAATGTCACTAAAGTACAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2014s1c1
Sequence:CCGGGCTGGACCTTATCAAGGGAATCTCGAGATTCCCTTGATAAGGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199161    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000180.1-3427s1c1
Sequence:CCGGCTGTCCCATCTGCAGTGGACCCTCGAGGGTCCACTGCAGATGGGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000180.1-2815s1c1
Sequence:CCGGCATCATTGGTTCCCACGATGTCTCGAGACATCGTGGGAACCAATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130693
GUCY2D MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 2D, membrane (retina-specific)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-1070s21c1
Sequence:CCGGCACTCTTTGGAACTATCTATGCTCGAGCATAGATAGTTCCAAAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-2738s21c1
Sequence:CCGGATGATCTCTACACGCTGTTTGCTCGAGCAAACAGCGTGTAGAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-2768s21c1
Sequence:CCGGTCGACAGCCATGATGTGTATACTCGAGTATACACATCATGGCTGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-2649s21c1
Sequence:CCGGCGACCAGGTCACCATCTATTTCTCGAGAAATAGATGGTGACCTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-282s21c1
Sequence:CCGGGCTGGCTGTAGATCAAGTTAACTCGAGTTAACTTGATCTACAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130693
GUCY2D MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 2D, membrane (retina-specific)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-1070s21c1
Sequence:CCGGCACTCTTTGGAACTATCTATGCTCGAGCATAGATAGTTCCAAAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-2738s21c1
Sequence:CCGGATGATCTCTACACGCTGTTTGCTCGAGCAAACAGCGTGTAGAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-2768s21c1
Sequence:CCGGTCGACAGCCATGATGTGTATACTCGAGTATACACATCATGGCTGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-2649s21c1
Sequence:CCGGCGACCAGGTCACCATCTATTTCTCGAGAAATAGATGGTGACCTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-282s21c1
Sequence:CCGGGCTGGCTGTAGATCAAGTTAACTCGAGTTAACTTGATCTACAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130693
GUCY2D MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 2D, membrane (retina-specific)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-1070s21c1
Sequence:CCGGCACTCTTTGGAACTATCTATGCTCGAGCATAGATAGTTCCAAAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-2738s21c1
Sequence:CCGGATGATCTCTACACGCTGTTTGCTCGAGCAAACAGCGTGTAGAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-2768s21c1
Sequence:CCGGTCGACAGCCATGATGTGTATACTCGAGTATACACATCATGGCTGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-2649s21c1
Sequence:CCGGCGACCAGGTCACCATCTATTTCTCGAGAAATAGATGGTGACCTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130693.1-282s21c1
Sequence:CCGGGCTGGCTGTAGATCAAGTTAACTCGAGTTAACTTGATCTACAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)