EMAIL THIS PAGE TO A FRIEND

GUCY2F

guanylate cyclase 2F, retinal

70 Gene Product Result for
Synonyms: CYGF GC-F GUC2DL GUC2F RETGC-2 ROS-GC2
UniProtKB ID: P51841, Q9UJF1
Gene ID:
Human(2986) Summary: The protein encoded by this gene is a guanylyl cyclase found predominantly in photoreceptors in the retina. The encoded protein is thought to be involved in resynthesis of cGMP after light activation of the visual signal transduction cascade, allowing a return to the dark state. This protein is a single-pass type I membrane protein. Defects in this gene may be a cause of X-linked retinitis pigmentosa. [provided by RefSeq, Dec 2008]
Mouse(245650) guanylate cyclase 2f
Rat(116556) guanylate cyclase 2F
Zebrafish(140424) guanylate cyclase 2F, retinal
chicken(419089) guanylate cyclase 2F, retinal
domestic cat(101090242) guanylate cyclase 2F, retinal
cow(282246) guanylate cyclase 2F, retinal
Horse(100054502) guanylate cyclase 2F, retinal
dog(481016) guanylate cyclase 2F, retinal
sheep(101112033) guanylate cyclase 2F, retinal
domestic guinea pig(100722890) guanylate cyclase 2F, retinal
naked mole-rat(101707903) guanylate cyclase 2F, retinal
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001522 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001522 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001522 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_142224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_142224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_142224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001522 Rosetta Predictions human pricing
NM_053831 Rosetta Predictions rat pricing
NM_001007576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332049 predicted 2280
2 SASI_Hs01_00116620 predicted 2332
3 SASI_Hs02_00332050 predicted 1733
4 SASI_Hs01_00116621 predicted 503
5 SASI_Hs01_00116622 predicted 3135
6 SASI_Hs02_00332051 predicted 994
7 SASI_Hs02_00332052 predicted 2971
8 SASI_Hs02_00332053 predicted 1762
9 SASI_Hs01_00116625 predicted 1868
10 SASI_Hs01_00116626 predicted 2617
11 SASI_Hs01_00116623 predicted 1353
12 SASI_Hs01_00116624 predicted 1069
13 SASI_Hs01_00116627 predicted 3342
14 SASI_Hs01_00116628 predicted 1805
15 SASI_Hs01_00116629 predicted 2188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053831 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085878 predicted 1835
2 SASI_Rn02_00266665 predicted 3246
3 SASI_Rn02_00266666 predicted 2012
4 SASI_Rn01_00085880 predicted 1300
5 SASI_Rn01_00085881 predicted 1170
6 SASI_Rn01_00085882 predicted 1418
7 SASI_Rn01_00085883 predicted 1453
8 SASI_Rn01_00085885 predicted 3232
9 SASI_Rn01_00085886 predicted 1719
10 SASI_Rn02_00266667 predicted 2143
11 SASI_Rn01_00085879 predicted 348
12 SASI_Rn01_00085884 predicted 504
13 SASI_Rn01_00085887 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112809 predicted 957
2 SASI_Mm01_00112810 predicted 321
3 SASI_Mm02_00286755 predicted 685
4 SASI_Mm01_00112811 predicted 2129
5 SASI_Mm02_00286756 predicted 1568
6 SASI_Mm01_00112813 predicted 1991
7 SASI_Mm02_00286757 predicted 2581
8 SASI_Mm01_00112814 predicted 2055
9 SASI_Mm01_00112815 predicted 2866
10 SASI_Mm01_00112817 predicted 2926
11 SASI_Mm01_00112812 predicted 1700
12 SASI_Mm01_00112816 predicted 3502
13 SASI_Mm01_00112818 predicted 2216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001522
GUCY2F MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 2F, retinal
Human
21 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1349s21c1
Sequence:CCGGTTATCGCACAAGCCATGAATACTCGAGTATTCATGGCTTGTGCGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2240s21c1
Sequence:CCGGTAAAGGGCATGAAGTACTTACCTCGAGGTAAGTACTTCATGCCCTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2749s21c1
Sequence:CCGGCTTCGGATGTTGGAGCAATATCTCGAGATATTGCTCCAACATCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1199s21c1
Sequence:CCGGATGATGCAGTGTTGACCATTACTCGAGTAATGGTCAACACTGCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2075s21c1
Sequence:CCGGACTTGCGTCATGAGAATATTACTCGAGTAATATTCTCATGACGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1684s21c1
Sequence:CCGGATGATGGTCTGCCTTACTTTGCTCGAGCAAAGTAAGGCAGACCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1707s21c1
Sequence:GTACCGGTATAGCCCTGCTGTCTATTAACTCGAGTTAATAGACAGCAGGGCTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001522.2-3642s21c1
Sequence:CCGGAGGCAATGGGAAAGCTCACTTCTCGAGAAGTGAGCTTTCCCATTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1955s21c1
Sequence:CCGGACTCCAACATAGCGATTTATGCTCGAGCATAAATCGCTATGTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1803s21c1
Sequence:CCGGTTTGGAGGATGTAACGTTTATCTCGAGATAAACGTTACATCCTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1129s21c1
Sequence:CCGGCTCTACAGTTTACCTTATAAGCTCGAGCTTATAAGGTAAACTGTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2046s21c1
Sequence:CCGGAGCAAGTGATGTGTTCGAAATCTCGAGATTTCGAACACATCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-3014s21c1
Sequence:CCGGACACACTCTTTGATGCAATAACTCGAGTTATTGCATCAAAGAGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001522.x-3665s1c1
Sequence:CCGGAGGCAATGGGAAAGCTCACTTCTCGAGAAGTGAGCTTTCCCATTGCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.x-2293s1c1
Sequence:CCGGAGTTTGTTCATGGGAGGCTAACTCGAGTTAGCCTCCCATGAACAAACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.x-3035s1c1
Sequence:CCGGGTACACACTCTTTGATGCAATCTCGAGATTGCATCAAAGAGTGTGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-2950s1c1
Sequence:CCGGCCTTGTACTTCAGCGACATTGCTCGAGCAATGTCGCTGAAGTACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-1825s1c1
Sequence:CCGGCTTTGGAGGATGTAACGTTTACTCGAGTAAACGTTACATCCTCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-2219s1c1
Sequence:CCGGGAAACTTGACTGGATGTTTAACTCGAGTTAAACATCCAGTCAAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-528s1c1
Sequence:CCGGCGATTAGCCATTGAGCGAATCCTCGAGGATTCGCTCAATGGCTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-1151s1c1
Sequence:CCGGGCTCTACAGTTTACCTTATAACTCGAGTTATAAGGTAAACTGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001522
GUCY2F MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 2F, retinal
Human
21 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1349s21c1
Sequence:CCGGTTATCGCACAAGCCATGAATACTCGAGTATTCATGGCTTGTGCGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2240s21c1
Sequence:CCGGTAAAGGGCATGAAGTACTTACCTCGAGGTAAGTACTTCATGCCCTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2749s21c1
Sequence:CCGGCTTCGGATGTTGGAGCAATATCTCGAGATATTGCTCCAACATCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1199s21c1
Sequence:CCGGATGATGCAGTGTTGACCATTACTCGAGTAATGGTCAACACTGCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2075s21c1
Sequence:CCGGACTTGCGTCATGAGAATATTACTCGAGTAATATTCTCATGACGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1684s21c1
Sequence:CCGGATGATGGTCTGCCTTACTTTGCTCGAGCAAAGTAAGGCAGACCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1707s21c1
Sequence:GTACCGGTATAGCCCTGCTGTCTATTAACTCGAGTTAATAGACAGCAGGGCTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001522.2-3642s21c1
Sequence:CCGGAGGCAATGGGAAAGCTCACTTCTCGAGAAGTGAGCTTTCCCATTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1955s21c1
Sequence:CCGGACTCCAACATAGCGATTTATGCTCGAGCATAAATCGCTATGTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1803s21c1
Sequence:CCGGTTTGGAGGATGTAACGTTTATCTCGAGATAAACGTTACATCCTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1129s21c1
Sequence:CCGGCTCTACAGTTTACCTTATAAGCTCGAGCTTATAAGGTAAACTGTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2046s21c1
Sequence:CCGGAGCAAGTGATGTGTTCGAAATCTCGAGATTTCGAACACATCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-3014s21c1
Sequence:CCGGACACACTCTTTGATGCAATAACTCGAGTTATTGCATCAAAGAGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001522.x-3665s1c1
Sequence:CCGGAGGCAATGGGAAAGCTCACTTCTCGAGAAGTGAGCTTTCCCATTGCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.x-2293s1c1
Sequence:CCGGAGTTTGTTCATGGGAGGCTAACTCGAGTTAGCCTCCCATGAACAAACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.x-3035s1c1
Sequence:CCGGGTACACACTCTTTGATGCAATCTCGAGATTGCATCAAAGAGTGTGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-2950s1c1
Sequence:CCGGCCTTGTACTTCAGCGACATTGCTCGAGCAATGTCGCTGAAGTACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-1825s1c1
Sequence:CCGGCTTTGGAGGATGTAACGTTTACTCGAGTAAACGTTACATCCTCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-2219s1c1
Sequence:CCGGGAAACTTGACTGGATGTTTAACTCGAGTTAAACATCCAGTCAAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-528s1c1
Sequence:CCGGCGATTAGCCATTGAGCGAATCCTCGAGGATTCGCTCAATGGCTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-1151s1c1
Sequence:CCGGGCTCTACAGTTTACCTTATAACTCGAGTTATAAGGTAAACTGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001522
GUCY2F MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 2F, retinal
Human
21 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1349s21c1
Sequence:CCGGTTATCGCACAAGCCATGAATACTCGAGTATTCATGGCTTGTGCGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2240s21c1
Sequence:CCGGTAAAGGGCATGAAGTACTTACCTCGAGGTAAGTACTTCATGCCCTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2749s21c1
Sequence:CCGGCTTCGGATGTTGGAGCAATATCTCGAGATATTGCTCCAACATCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1199s21c1
Sequence:CCGGATGATGCAGTGTTGACCATTACTCGAGTAATGGTCAACACTGCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2075s21c1
Sequence:CCGGACTTGCGTCATGAGAATATTACTCGAGTAATATTCTCATGACGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1684s21c1
Sequence:CCGGATGATGGTCTGCCTTACTTTGCTCGAGCAAAGTAAGGCAGACCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1707s21c1
Sequence:GTACCGGTATAGCCCTGCTGTCTATTAACTCGAGTTAATAGACAGCAGGGCTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001522.2-3642s21c1
Sequence:CCGGAGGCAATGGGAAAGCTCACTTCTCGAGAAGTGAGCTTTCCCATTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1955s21c1
Sequence:CCGGACTCCAACATAGCGATTTATGCTCGAGCATAAATCGCTATGTTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1803s21c1
Sequence:CCGGTTTGGAGGATGTAACGTTTATCTCGAGATAAACGTTACATCCTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-1129s21c1
Sequence:CCGGCTCTACAGTTTACCTTATAAGCTCGAGCTTATAAGGTAAACTGTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-2046s21c1
Sequence:CCGGAGCAAGTGATGTGTTCGAAATCTCGAGATTTCGAACACATCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001522.2-3014s21c1
Sequence:CCGGACACACTCTTTGATGCAATAACTCGAGTTATTGCATCAAAGAGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001522.x-3665s1c1
Sequence:CCGGAGGCAATGGGAAAGCTCACTTCTCGAGAAGTGAGCTTTCCCATTGCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.x-2293s1c1
Sequence:CCGGAGTTTGTTCATGGGAGGCTAACTCGAGTTAGCCTCCCATGAACAAACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.x-3035s1c1
Sequence:CCGGGTACACACTCTTTGATGCAATCTCGAGATTGCATCAAAGAGTGTGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-2950s1c1
Sequence:CCGGCCTTGTACTTCAGCGACATTGCTCGAGCAATGTCGCTGAAGTACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-1825s1c1
Sequence:CCGGCTTTGGAGGATGTAACGTTTACTCGAGTAAACGTTACATCCTCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-2219s1c1
Sequence:CCGGGAAACTTGACTGGATGTTTAACTCGAGTTAAACATCCAGTCAAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-528s1c1
Sequence:CCGGCGATTAGCCATTGAGCGAATCCTCGAGGATTCGCTCAATGGCTAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001522.1-1151s1c1
Sequence:CCGGGCTCTACAGTTTACCTTATAACTCGAGTTATAAGGTAAACTGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007576
GUCY2F MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 2F, retinal
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007576.1-1163s21c1
Sequence:CCGGATGATGCTGTGTTGACTATTACTCGAGTAATAGTCAACACAGCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007576.1-3869s21c1
Sequence:CCGGACACCCAGGAGAGGGATATAACTCGAGTTATATCCCTCTCCTGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007576.1-3222s21c1
Sequence:CCGGCCTCACCATGCCCAGATATTGCTCGAGCAATATCTGGGCATGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007576.1-2423s21c1
Sequence:CCGGCATTTGCAGGAGACGTCTATACTCGAGTATAGACGTCTCCTGCAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007576
GUCY2F MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 2F, retinal
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007576.1-1163s21c1
Sequence:CCGGATGATGCTGTGTTGACTATTACTCGAGTAATAGTCAACACAGCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007576.1-3869s21c1
Sequence:CCGGACACCCAGGAGAGGGATATAACTCGAGTTATATCCCTCTCCTGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007576.1-3222s21c1
Sequence:CCGGCCTCACCATGCCCAGATATTGCTCGAGCAATATCTGGGCATGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007576.1-2423s21c1
Sequence:CCGGCATTTGCAGGAGACGTCTATACTCGAGTATAGACGTCTCCTGCAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007576
GUCY2F MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 2F, retinal
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007576.1-1163s21c1
Sequence:CCGGATGATGCTGTGTTGACTATTACTCGAGTAATAGTCAACACAGCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007576.1-3869s21c1
Sequence:CCGGACACCCAGGAGAGGGATATAACTCGAGTTATATCCCTCTCCTGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007576.1-3222s21c1
Sequence:CCGGCCTCACCATGCCCAGATATTGCTCGAGCAATATCTGGGCATGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007576.1-2423s21c1
Sequence:CCGGCATTTGCAGGAGACGTCTATACTCGAGTATAGACGTCTCCTGCAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_142224
GUCY2F MISSION shRNA Bacterial Glycerol Stock
guanylate cyclase 2F, retinal
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-3351s1c1
Sequence:CCGGCGAGTACAGATGAGAACAGATCTCGAGATCTGTTCTCATCTGTACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-1736s1c1
Sequence:CCGGCCAGTTGATTAAAGGACCCAACTCGAGTTGGGTCCTTTAATCAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-2949s1c1
Sequence:CCGGCCCATTGAAGTTGTGGACCTTCTCGAGAAGGTCCACAACTTCAATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-1329s1c1
Sequence:CCGGGCCATGAATAATGCTATGAAACTCGAGTTTCATAGCATTATTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-3584s1c1
Sequence:CCGGCCACAGAGTTTCCATGAGGATCTCGAGATCCTCATGGAAACTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_142224
GUCY2F MISSION shRNA shRNA Plasmid DNA
guanylate cyclase 2F, retinal
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-3351s1c1
Sequence:CCGGCGAGTACAGATGAGAACAGATCTCGAGATCTGTTCTCATCTGTACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-1736s1c1
Sequence:CCGGCCAGTTGATTAAAGGACCCAACTCGAGTTGGGTCCTTTAATCAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-2949s1c1
Sequence:CCGGCCCATTGAAGTTGTGGACCTTCTCGAGAAGGTCCACAACTTCAATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-1329s1c1
Sequence:CCGGGCCATGAATAATGCTATGAAACTCGAGTTTCATAGCATTATTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-3584s1c1
Sequence:CCGGCCACAGAGTTTCCATGAGGATCTCGAGATCCTCATGGAAACTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_142224
GUCY2F MISSION shRNA Lentiviral Transduction Particles
guanylate cyclase 2F, retinal
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-3351s1c1
Sequence:CCGGCGAGTACAGATGAGAACAGATCTCGAGATCTGTTCTCATCTGTACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-1736s1c1
Sequence:CCGGCCAGTTGATTAAAGGACCCAACTCGAGTTGGGTCCTTTAATCAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-2949s1c1
Sequence:CCGGCCCATTGAAGTTGTGGACCTTCTCGAGAAGGTCCACAACTTCAATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-1329s1c1
Sequence:CCGGGCCATGAATAATGCTATGAAACTCGAGTTTCATAGCATTATTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_142224.3-3584s1c1
Sequence:CCGGCCACAGAGTTTCCATGAGGATCTCGAGATCCTCATGGAAACTCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)