EMAIL THIS PAGE TO A FRIEND

GUF1

GUF1 GTPase homolog (S. cerevisiae)

51 Gene Product Result for
Synonyms: EF-4
UniProtKB ID: Q8N442, Q5XKM8, Q9H710, Q9H8U4
Gene ID:
Mouse(231279) GUF1 GTPase homolog (S. cerevisiae)
Rat(305317) GUF1 GTPase homolog (S. cerevisiae)
Zebrafish(553030) GUF1 GTPase homolog (S. cerevisiae)
chicken(422773) GUF1 GTPase homolog (S. cerevisiae)
domestic cat(101090862) GUF1 GTPase homolog (S. cerevisiae)
cow(522459) GUF1 GTPase homolog (S. cerevisiae)
Horse(100062367) GUF1 GTPase homolog (S. cerevisiae)
dog(482127) GUF1 GTPase homolog (S. cerevisiae)
sheep(101120330) GUF1 GTPase homolog (S. cerevisiae)
Domestic Rabbit(100338633) GUF1 GTPase homolog (S. cerevisiae)
naked mole-rat(101721953) GUF1 GTPase homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021927 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021927 Rosetta Predictions human pricing
NM_001107215 Rosetta Predictions rat pricing
NM_172711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100231 predicted 474
2 SASI_Hs02_00355209 predicted 1343
3 SASI_Hs01_00100232 predicted 1271
4 SASI_Hs02_00355210 predicted 1183
5 SASI_Hs01_00100233 predicted 1902
6 SASI_Hs01_00100234 predicted 859
7 SASI_Hs01_00100235 predicted 989
8 SASI_Hs01_00100236 predicted 726
9 SASI_Hs01_00100237 predicted 1003
10 SASI_Hs01_00100238 predicted 1288
11 SASI_Hs01_00100239 predicted 665
12 SASI_Hs01_00100240 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226645 predicted 275
2 SASI_Rn02_00226646 predicted 1772
3 SASI_Rn02_00226647 predicted 1738
4 SASI_Rn02_00226648 predicted 1163
5 SASI_Rn02_00226649 predicted 1029
6 SASI_Rn02_00226650 predicted 1090
7 SASI_Rn02_00226651 predicted 1203
8 SASI_Rn02_00226652 predicted 625
9 SASI_Rn02_00226653 predicted 924
10 SASI_Rn02_00226654 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031407 predicted 1129
2 SASI_Mm01_00031408 predicted 1186
3 SASI_Mm01_00031409 predicted 1214
4 SASI_Mm01_00031410 predicted 708
5 SASI_Mm01_00031412 predicted 1143
6 SASI_Mm01_00031413 predicted 1145
7 SASI_Mm01_00031414 predicted 1583
8 SASI_Mm01_00031415 predicted 557
9 SASI_Mm01_00031416 predicted 1035
10 SASI_Mm02_00344487 predicted 219
11 SASI_Mm01_00031411 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021927
VALIDATED
GUF1 MISSION shRNA Bacterial Glycerol Stock
GUF1 GTPase homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021927.2-1187s21c1
Sequence:CCGGATGTCACTGAAGCGCAAATAGCTCGAGCTATTTGCGCTTCAGTGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021927.2-2358s21c1
Sequence:CCGGGGTAGGCAAGAGCTTAGATTTCTCGAGAAATCTAAGCTCTTGCCTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021927.2-2335s21c1
Sequence:CCGGTCGTTGAAAGGGAGTAGTTAGCTCGAGCTAACTACTCCCTTTCAACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021927.2-907s21c1
Sequence:CCGGAGTGTTCTTCAGGCAATTATTCTCGAGAATAATTGCCTGAAGAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021927.1-1847s1c1
Sequence:CCGGGAGGAGCTAGTAACTGTTGTACTCGAGTACAACAGTTACTAGCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021927.1-1928s1c1
Sequence:CCGGCCTAGGCAACTGTTTGAGATACTCGAGTATCTCAAACAGTTGCCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021927.1-759s1c1
Sequence:CCGGCTGATCCTGAAAGGGTTGAAACTCGAGTTTCAACCCTTTCAGGATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_021927.1-1199s1c1
Sequence:CCGGCCTGGGTTTAAATCAGCGAAACTCGAGTTTCGCTGATTTAAACCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_021927.1-421s1c1
Sequence:CCGGCCTAGAACTTACAGGGACAATCTCGAGATTGTCCCTGTAAGTTCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_021927.1-1907s1c1
Sequence:CCGGGAACGGCTGAAGGATTCTCTTCTCGAGAAGAGAATCCTTCAGCCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021927.1-890s1c1
Sequence:CCGGCCTCCTAAAGTGCATCGCAAACTCGAGTTTGCGATGCACTTTAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_021927.1-1198s1c1
Sequence:CCGGGCCTGGGTTTAAATCAGCGAACTCGAGTTCGCTGATTTAAACCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021927.1-1945s1c1
Sequence:CCGGGATAGCAATTCAAGCTGCTATCTCGAGATAGCAGCTTGAATTGCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021927.1-1641s1c1
Sequence:CCGGGAAGAGCAGTTCAGAAGAATACTCGAGTATTCTTCTGAACTGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021927
VALIDATED
GUF1 MISSION shRNA shRNA Plasmid DNA
GUF1 GTPase homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021927.2-1187s21c1
Sequence:CCGGATGTCACTGAAGCGCAAATAGCTCGAGCTATTTGCGCTTCAGTGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021927.2-2358s21c1
Sequence:CCGGGGTAGGCAAGAGCTTAGATTTCTCGAGAAATCTAAGCTCTTGCCTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021927.2-2335s21c1
Sequence:CCGGTCGTTGAAAGGGAGTAGTTAGCTCGAGCTAACTACTCCCTTTCAACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021927.2-907s21c1
Sequence:CCGGAGTGTTCTTCAGGCAATTATTCTCGAGAATAATTGCCTGAAGAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021927.1-1847s1c1
Sequence:CCGGGAGGAGCTAGTAACTGTTGTACTCGAGTACAACAGTTACTAGCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021927.1-1928s1c1
Sequence:CCGGCCTAGGCAACTGTTTGAGATACTCGAGTATCTCAAACAGTTGCCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021927.1-759s1c1
Sequence:CCGGCTGATCCTGAAAGGGTTGAAACTCGAGTTTCAACCCTTTCAGGATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_021927.1-1199s1c1
Sequence:CCGGCCTGGGTTTAAATCAGCGAAACTCGAGTTTCGCTGATTTAAACCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_021927.1-421s1c1
Sequence:CCGGCCTAGAACTTACAGGGACAATCTCGAGATTGTCCCTGTAAGTTCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_021927.1-1907s1c1
Sequence:CCGGGAACGGCTGAAGGATTCTCTTCTCGAGAAGAGAATCCTTCAGCCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021927.1-890s1c1
Sequence:CCGGCCTCCTAAAGTGCATCGCAAACTCGAGTTTGCGATGCACTTTAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_021927.1-1198s1c1
Sequence:CCGGGCCTGGGTTTAAATCAGCGAACTCGAGTTCGCTGATTTAAACCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021927.1-1945s1c1
Sequence:CCGGGATAGCAATTCAAGCTGCTATCTCGAGATAGCAGCTTGAATTGCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021927.1-1641s1c1
Sequence:CCGGGAAGAGCAGTTCAGAAGAATACTCGAGTATTCTTCTGAACTGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021927
VALIDATED
GUF1 MISSION shRNA Lentiviral Transduction Particles
GUF1 GTPase homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021927.2-1187s21c1
Sequence:CCGGATGTCACTGAAGCGCAAATAGCTCGAGCTATTTGCGCTTCAGTGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427819    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021927.2-2358s21c1
Sequence:CCGGGGTAGGCAAGAGCTTAGATTTCTCGAGAAATCTAAGCTCTTGCCTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021927.2-2335s21c1
Sequence:CCGGTCGTTGAAAGGGAGTAGTTAGCTCGAGCTAACTACTCCCTTTCAACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021927.2-907s21c1
Sequence:CCGGAGTGTTCTTCAGGCAATTATTCTCGAGAATAATTGCCTGAAGAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021927.1-1847s1c1
Sequence:CCGGGAGGAGCTAGTAACTGTTGTACTCGAGTACAACAGTTACTAGCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021927.1-1928s1c1
Sequence:CCGGCCTAGGCAACTGTTTGAGATACTCGAGTATCTCAAACAGTTGCCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021927.1-759s1c1
Sequence:CCGGCTGATCCTGAAAGGGTTGAAACTCGAGTTTCAACCCTTTCAGGATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_021927.1-1199s1c1
Sequence:CCGGCCTGGGTTTAAATCAGCGAAACTCGAGTTTCGCTGATTTAAACCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_021927.1-421s1c1
Sequence:CCGGCCTAGAACTTACAGGGACAATCTCGAGATTGTCCCTGTAAGTTCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_021927.1-1907s1c1
Sequence:CCGGGAACGGCTGAAGGATTCTCTTCTCGAGAAGAGAATCCTTCAGCCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021927.1-890s1c1
Sequence:CCGGCCTCCTAAAGTGCATCGCAAACTCGAGTTTGCGATGCACTTTAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_021927.1-1198s1c1
Sequence:CCGGGCCTGGGTTTAAATCAGCGAACTCGAGTTCGCTGATTTAAACCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021927.1-1945s1c1
Sequence:CCGGGATAGCAATTCAAGCTGCTATCTCGAGATAGCAGCTTGAATTGCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021927.1-1641s1c1
Sequence:CCGGGAAGAGCAGTTCAGAAGAATACTCGAGTATTCTTCTGAACTGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172711
GUF1 MISSION shRNA Bacterial Glycerol Stock
GUF1 GTPase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-304s1c1
Sequence:CCGGCCTGGAGCTAACAGGAACAATCTCGAGATTGTTCCTGTTAGCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-1811s1c1
Sequence:CCGGCCCAGACAACTGTATGAGATACTCGAGTATCTCATACAGTTGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172711.1-2070s1c1
Sequence:CCGGCTCTGTTCCTTCTCATTTATACTCGAGTATAAATGAGAAGGAACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-1815s1c1
Sequence:CCGGGACAACTGTATGAGATAGCAACTCGAGTTGCTATCTCATACAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-1282s1c1
Sequence:CCGGCCAGCGATTAGAGCAAGAATACTCGAGTATTCTTGCTCTAATCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172711
GUF1 MISSION shRNA shRNA Plasmid DNA
GUF1 GTPase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-304s1c1
Sequence:CCGGCCTGGAGCTAACAGGAACAATCTCGAGATTGTTCCTGTTAGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-1811s1c1
Sequence:CCGGCCCAGACAACTGTATGAGATACTCGAGTATCTCATACAGTTGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172711.1-2070s1c1
Sequence:CCGGCTCTGTTCCTTCTCATTTATACTCGAGTATAAATGAGAAGGAACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-1815s1c1
Sequence:CCGGGACAACTGTATGAGATAGCAACTCGAGTTGCTATCTCATACAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-1282s1c1
Sequence:CCGGCCAGCGATTAGAGCAAGAATACTCGAGTATTCTTGCTCTAATCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172711
GUF1 MISSION shRNA Lentiviral Transduction Particles
GUF1 GTPase homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-304s1c1
Sequence:CCGGCCTGGAGCTAACAGGAACAATCTCGAGATTGTTCCTGTTAGCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-1811s1c1
Sequence:CCGGCCCAGACAACTGTATGAGATACTCGAGTATCTCATACAGTTGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172711.1-2070s1c1
Sequence:CCGGCTCTGTTCCTTCTCATTTATACTCGAGTATAAATGAGAAGGAACAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-1815s1c1
Sequence:CCGGGACAACTGTATGAGATAGCAACTCGAGTTGCTATCTCATACAGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172711.1-1282s1c1
Sequence:CCGGCCAGCGATTAGAGCAAGAATACTCGAGTATTCTTGCTCTAATCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)