EMAIL THIS PAGE TO A FRIEND

GULP1

GULP, engulfment adaptor PTB domain containing 1

154 Gene Product Result for
Synonyms: CED-6 CED6 GULP
Gene ID:
Human(51454) Summary: The protein encoded by this gene is an adapter protein necessary for the engulfment of apoptotic cells by phagocytes. Several transcript variants, some protein coding and some thought not to be protein coding, have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(70676) GULP, engulfment adaptor PTB domain containing 1
Rat(314543) GULP, engulfment adaptor PTB domain containing 1
chicken(423988) GULP, engulfment adaptor PTB domain containing 1
domestic cat(101100580) GULP, engulfment adaptor PTB domain containing 1
cow(615926) GULP, engulfment adaptor PTB domain containing 1
dog(478834) GULP, engulfment adaptor PTB domain containing 1
domestic guinea pig(100730136) GULP, engulfment adaptor PTB domain containing 1
naked mole-rat(101707371) GULP, engulfment adaptor PTB domain containing 1
sheep(101115004) GULP, engulfment adaptor PTB domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028450 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028450 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028450 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016315 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081331 MISSION® esiRNA esiRNA human GULP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016315 Rosetta Predictions human pricing
NM_001013171 Rosetta Predictions rat pricing
NM_027506 Rosetta Predictions mouse pricing
NM_028450 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151353 predicted 890
2 SASI_Hs01_00151354 predicted 1200
3 SASI_Hs01_00151355 predicted 768
4 SASI_Hs01_00151356 predicted 1258
5 SASI_Hs01_00151357 predicted 936
6 SASI_Hs01_00151358 predicted 654
7 SASI_Hs01_00151359 predicted 770
8 SASI_Hs01_00151360 predicted 743
9 SASI_Hs01_00151361 predicted 831
10 SASI_Hs02_00349251 predicted 1416
11 SASI_Hs01_00151352 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043654 predicted 1088
2 SASI_Rn01_00043655 predicted 597
3 SASI_Rn01_00043657 predicted 1027
4 SASI_Rn02_00200924 predicted 355
5 SASI_Rn02_00200925 predicted 501
6 SASI_Rn01_00043659 predicted 455
7 SASI_Rn01_00043661 predicted 529
8 SASI_Rn01_00043662 predicted 306
9 SASI_Rn01_00043663 predicted 298
10 SASI_Rn02_00200926 predicted 910
11 SASI_Rn01_00043656 predicted 970
12 SASI_Rn01_00043658 predicted 315
13 SASI_Rn01_00043660 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029080 predicted 627
2 SASI_Mm01_00029081 predicted 495
3 SASI_Mm01_00029082 predicted 621
4 SASI_Mm01_00029083 predicted 562
5 SASI_Mm01_00029084 predicted 545
6 SASI_Mm01_00029085 predicted 546
7 SASI_Mm01_00029086 predicted 496
8 SASI_Mm01_00029087 predicted 550
9 SASI_Mm01_00029088 predicted 498
10 SASI_Mm01_00029089 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333886 predicted 1224
2 SASI_Mm02_00333887 predicted 329
3 SASI_Mm02_00333888 predicted 253
4 SASI_Mm02_00333889 predicted 280
5 SASI_Mm01_00023734 predicted 568
6 SASI_Mm01_00023735 predicted 512
7 SASI_Mm02_00333890 predicted 1107
8 SASI_Mm02_00333891 predicted 439
9 SASI_Mm02_00333892 predicted 592
10 SASI_Mm02_00333893 predicted 762
11 SASI_Mm01_00023729 predicted 395
12 SASI_Mm01_00023730 predicted 265
13 SASI_Mm01_00023731 predicted 389
14 SASI_Mm01_00023732 predicted 342
15 SASI_Mm01_00023733 predicted 316
16 SASI_Mm01_00023736 predicted 318
17 SASI_Mm01_00023737 predicted 270
18 SASI_Mm01_00023738 predicted 484
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028450
GULP1 MISSION shRNA Bacterial Glycerol Stock
GULP, engulfment adaptor PTB domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028450.1-1854s1c1
Sequence:CCGGGCTCTGTTAAAGTCAGAATTTCTCGAGAAATTCTGACTTTAACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-274s1c1
Sequence:CCGGCCAGCTTCATAGAATATCATTCTCGAGAATGATATTCTATGAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-803s1c1
Sequence:CCGGCCTCCTGATATTCAGTCCAAACTCGAGTTTGGACTGAATATCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-804s1c1
Sequence:CCGGCTCCTGATATTCAGTCCAAATCTCGAGATTTGGACTGAATATCAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-273s1c1
Sequence:CCGGGCCAGCTTCATAGAATATCATCTCGAGATGATATTCTATGAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028450.3-887s21c1
Sequence:CCGGCTGATATCTTTGACATGATTCCTCGAGGAATCATGTCAAAGATATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028450.3-1635s21c1
Sequence:CCGGACCTAAAGCTTAGCTATTATGCTCGAGCATAATAGCTAAGCTTTAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028450.3-1448s21c1
Sequence:CCGGCCTTGACATTTATGCTCATTCCTCGAGGAATGAGCATAAATGTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028450.3-569s21c1
Sequence:CCGGAGAGGATATTCACTTTCATATCTCGAGATATGAAAGTGAATATCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028450
GULP1 MISSION shRNA shRNA Plasmid DNA
GULP, engulfment adaptor PTB domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028450.1-1854s1c1
Sequence:CCGGGCTCTGTTAAAGTCAGAATTTCTCGAGAAATTCTGACTTTAACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-274s1c1
Sequence:CCGGCCAGCTTCATAGAATATCATTCTCGAGAATGATATTCTATGAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-803s1c1
Sequence:CCGGCCTCCTGATATTCAGTCCAAACTCGAGTTTGGACTGAATATCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-804s1c1
Sequence:CCGGCTCCTGATATTCAGTCCAAATCTCGAGATTTGGACTGAATATCAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-273s1c1
Sequence:CCGGGCCAGCTTCATAGAATATCATCTCGAGATGATATTCTATGAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028450.3-887s21c1
Sequence:CCGGCTGATATCTTTGACATGATTCCTCGAGGAATCATGTCAAAGATATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028450.3-1635s21c1
Sequence:CCGGACCTAAAGCTTAGCTATTATGCTCGAGCATAATAGCTAAGCTTTAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028450.3-1448s21c1
Sequence:CCGGCCTTGACATTTATGCTCATTCCTCGAGGAATGAGCATAAATGTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028450.3-569s21c1
Sequence:CCGGAGAGGATATTCACTTTCATATCTCGAGATATGAAAGTGAATATCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028450
GULP1 MISSION shRNA Lentiviral Transduction Particles
GULP, engulfment adaptor PTB domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028450.1-1854s1c1
Sequence:CCGGGCTCTGTTAAAGTCAGAATTTCTCGAGAAATTCTGACTTTAACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-274s1c1
Sequence:CCGGCCAGCTTCATAGAATATCATTCTCGAGAATGATATTCTATGAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-803s1c1
Sequence:CCGGCCTCCTGATATTCAGTCCAAACTCGAGTTTGGACTGAATATCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-804s1c1
Sequence:CCGGCTCCTGATATTCAGTCCAAATCTCGAGATTTGGACTGAATATCAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028450.1-273s1c1
Sequence:CCGGGCCAGCTTCATAGAATATCATCTCGAGATGATATTCTATGAAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028450.3-887s21c1
Sequence:CCGGCTGATATCTTTGACATGATTCCTCGAGGAATCATGTCAAAGATATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028450.3-1635s21c1
Sequence:CCGGACCTAAAGCTTAGCTATTATGCTCGAGCATAATAGCTAAGCTTTAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028450.3-1448s21c1
Sequence:CCGGCCTTGACATTTATGCTCATTCCTCGAGGAATGAGCATAAATGTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028450.3-569s21c1
Sequence:CCGGAGAGGATATTCACTTTCATATCTCGAGATATGAAAGTGAATATCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016315
VALIDATED
GULP1 MISSION shRNA Bacterial Glycerol Stock
GULP, engulfment adaptor PTB domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016315.1-802s1c1
Sequence:CCGGGCTATGTATTTGACAGCGAAACTCGAGTTTCGCTGTCAAATACATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016315.1-707s1c1
Sequence:CCGGCCAGCTTCATAGAATATCTTTCTCGAGAAAGATATTCTATGAAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_016315.1-772s1c1
Sequence:CCGGGCAAAGATTCTGAGTCAAATACTCGAGTATTTGACTCAGAATCTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016315.1-1096s1c1
Sequence:CCGGCTCCAATATCACACCAGTCTTCTCGAGAAGACTGGTGTGATATTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016315.1-1290s1c1
Sequence:CCGGCTAACTCTTGAAGGCACAGTACTCGAGTACTGTGCCTTCAAGAGTTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-822s21c1
Sequence:CCGGTCCTAAAGTGGAGTTGCAAATCTCGAGATTTGCAACTCCACTTTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-662s21c1
Sequence:CCGGTGCATACACCTGAAGCTTTATCTCGAGATAAAGCTTCAGGTGTATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-1018s21c1
Sequence:CCGGTGTGCTGAAGAGATCACTTTACTCGAGTAAAGTGATCTCTTCAGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-1486s21c1
Sequence:GTACCGGACTCTTGAAGGCACAGTATTTCTCGAGAAATACTGTGCCTTCAAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-2355s21c1
Sequence:CCGGCAGTATCTACTACCCATATTTCTCGAGAAATATGGGTAGTAGATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016315
VALIDATED
GULP1 MISSION shRNA shRNA Plasmid DNA
GULP, engulfment adaptor PTB domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016315.1-802s1c1
Sequence:CCGGGCTATGTATTTGACAGCGAAACTCGAGTTTCGCTGTCAAATACATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016315.1-707s1c1
Sequence:CCGGCCAGCTTCATAGAATATCTTTCTCGAGAAAGATATTCTATGAAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_016315.1-772s1c1
Sequence:CCGGGCAAAGATTCTGAGTCAAATACTCGAGTATTTGACTCAGAATCTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016315.1-1096s1c1
Sequence:CCGGCTCCAATATCACACCAGTCTTCTCGAGAAGACTGGTGTGATATTGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016315.1-1290s1c1
Sequence:CCGGCTAACTCTTGAAGGCACAGTACTCGAGTACTGTGCCTTCAAGAGTTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-822s21c1
Sequence:CCGGTCCTAAAGTGGAGTTGCAAATCTCGAGATTTGCAACTCCACTTTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-662s21c1
Sequence:CCGGTGCATACACCTGAAGCTTTATCTCGAGATAAAGCTTCAGGTGTATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-1018s21c1
Sequence:CCGGTGTGCTGAAGAGATCACTTTACTCGAGTAAAGTGATCTCTTCAGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-1486s21c1
Sequence:GTACCGGACTCTTGAAGGCACAGTATTTCTCGAGAAATACTGTGCCTTCAAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-2355s21c1
Sequence:CCGGCAGTATCTACTACCCATATTTCTCGAGAAATATGGGTAGTAGATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016315
VALIDATED
GULP1 MISSION shRNA Lentiviral Transduction Particles
GULP, engulfment adaptor PTB domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016315.1-802s1c1
Sequence:CCGGGCTATGTATTTGACAGCGAAACTCGAGTTTCGCTGTCAAATACATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_016315.1-707s1c1
Sequence:CCGGCCAGCTTCATAGAATATCTTTCTCGAGAAAGATATTCTATGAAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_016315.1-772s1c1
Sequence:CCGGGCAAAGATTCTGAGTCAAATACTCGAGTATTTGACTCAGAATCTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016315.1-1096s1c1
Sequence:CCGGCTCCAATATCACACCAGTCTTCTCGAGAAGACTGGTGTGATATTGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016315.1-1290s1c1
Sequence:CCGGCTAACTCTTGAAGGCACAGTACTCGAGTACTGTGCCTTCAAGAGTTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-822s21c1
Sequence:CCGGTCCTAAAGTGGAGTTGCAAATCTCGAGATTTGCAACTCCACTTTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-662s21c1
Sequence:CCGGTGCATACACCTGAAGCTTTATCTCGAGATAAAGCTTCAGGTGTATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-1018s21c1
Sequence:CCGGTGTGCTGAAGAGATCACTTTACTCGAGTAAAGTGATCTCTTCAGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-1486s21c1
Sequence:GTACCGGACTCTTGAAGGCACAGTATTTCTCGAGAAATACTGTGCCTTCAAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_016315.2-2355s21c1
Sequence:CCGGCAGTATCTACTACCCATATTTCTCGAGAAATATGGGTAGTAGATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)