EMAIL THIS PAGE TO A FRIEND

GUSB

glucuronidase, beta

56 Gene Product Result for
Synonyms: BG MPS7
UniProtKB ID: P08236, Q549U0, Q96CL9
Gene ID:
Human(2990) Summary: This gene encodes a hydrolase that degrades glycosaminoglycans, including heparan sulfate, dermatan sulfate, and chondroitin-4,6-sulfate. The enzyme forms a homotetramer that is localized to the lysosome. Mutations in this gene result in mucopolysaccharidosis type VII. There are many pseudogenes of this locus in the human genome.[provided by RefSeq, Nov 2009]
Mouse(110006) glucuronidase, beta
Rat(24434) glucuronidase, beta
Zebrafish(571441) glucuronidase, beta
domestic cat(493879) glucuronidase, beta
cow(515687) glucuronidase, beta
Horse(100037416) glucuronidase, beta
dog(403831) glucuronidase, beta
chicken(427823) glucuronidase, beta
domestic guinea pig(100733204) glucuronidase, beta
naked mole-rat(101709573) glucuronidase, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000181 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000181 Rosetta Predictions human pricing
NM_017015 Rosetta Predictions rat pricing
NM_010368 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170584 predicted 1509
2 SASI_Hs01_00170585 predicted 316
3 SASI_Hs02_00302022 predicted 571
4 SASI_Hs01_00170586 predicted 1446
5 SASI_Hs01_00170587 predicted 652
6 SASI_Hs01_00170588 predicted 1663
7 SASI_Hs01_00170589 predicted 1442
8 SASI_Hs01_00170590 predicted 1316
9 SASI_Hs01_00170591 predicted 810
10 SASI_Hs01_00170592 predicted 1690
11 SASI_Hs01_00170583 predicted 1517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104562 predicted 1399
2 SASI_Rn01_00104563 predicted 1509
3 SASI_Rn01_00104564 predicted 850
4 SASI_Rn01_00104565 predicted 632
5 SASI_Rn01_00104566 predicted 1522
6 SASI_Rn01_00104567 predicted 702
7 SASI_Rn01_00104568 predicted 1378
8 SASI_Rn01_00104569 predicted 1039
9 SASI_Rn01_00104570 predicted 1070
10 SASI_Rn01_00104571 predicted 1891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010368 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181367 predicted 1996
2 SASI_Mm01_00181368 predicted 1569
3 SASI_Mm01_00181369 predicted 682
4 SASI_Mm01_00181370 predicted 357
5 SASI_Mm01_00181372 predicted 1376
6 SASI_Mm01_00181373 predicted 1437
7 SASI_Mm01_00181374 predicted 2051
8 SASI_Mm01_00181375 predicted 1357
9 SASI_Mm01_00181376 predicted 2007
10 SASI_Mm02_00318428 predicted 1488
11 SASI_Mm01_00181371 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000181
VALIDATED
GUSB MISSION shRNA Bacterial Glycerol Stock
glucuronidase, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-574s21c1
Sequence:CCGGCCGAATCACTATCGCCATCAACTCGAGTTGATGGCGATAGTGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-1657s21c1
Sequence:CCGGCTGGTATAAGAAGTATCAGAACTCGAGTTCTGATACTTCTTATACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-963s21c1
Sequence:CCGGGCCCTGCCTATCTGTATTCATCTCGAGATGAATACAGATAGGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-1994s21c1
Sequence:CCGGGCCAAGTCACAATGTTTGGAACTCGAGTTCCAAACATTGTGACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000181.1-1944s1c1
Sequence:CCGGGCCAAGTCACAATGTTTGGAACTCGAGTTCCAAACATTGTGACTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000181.1-524s1c1
Sequence:CCGGCCGAATCACTATCGCCATCAACTCGAGTTGATGGCGATAGTGATTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000181.1-913s1c1
Sequence:CCGGGCCCTGCCTATCTGTATTCATCTCGAGATGAATACAGATAGGCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_000181.1-1607s1c1
Sequence:CCGGCTGGTATAAGAAGTATCAGAACTCGAGTTCTGATACTTCTTATACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000181.1-1653s1c1
Sequence:CCGGGCAGAAACGATTGCAGGGTTTCTCGAGAAACCCTGCAATCGTTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-1703s21c1
Sequence:CCGGGCAGAAACGATTGCAGGGTTTCTCGAGAAACCCTGCAATCGTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000181
VALIDATED
GUSB MISSION shRNA shRNA Plasmid DNA
glucuronidase, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-574s21c1
Sequence:CCGGCCGAATCACTATCGCCATCAACTCGAGTTGATGGCGATAGTGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-1657s21c1
Sequence:CCGGCTGGTATAAGAAGTATCAGAACTCGAGTTCTGATACTTCTTATACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-963s21c1
Sequence:CCGGGCCCTGCCTATCTGTATTCATCTCGAGATGAATACAGATAGGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-1994s21c1
Sequence:CCGGGCCAAGTCACAATGTTTGGAACTCGAGTTCCAAACATTGTGACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000181.1-1944s1c1
Sequence:CCGGGCCAAGTCACAATGTTTGGAACTCGAGTTCCAAACATTGTGACTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000181.1-524s1c1
Sequence:CCGGCCGAATCACTATCGCCATCAACTCGAGTTGATGGCGATAGTGATTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000181.1-913s1c1
Sequence:CCGGGCCCTGCCTATCTGTATTCATCTCGAGATGAATACAGATAGGCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_000181.1-1607s1c1
Sequence:CCGGCTGGTATAAGAAGTATCAGAACTCGAGTTCTGATACTTCTTATACCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000181.1-1653s1c1
Sequence:CCGGGCAGAAACGATTGCAGGGTTTCTCGAGAAACCCTGCAATCGTTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-1703s21c1
Sequence:CCGGGCAGAAACGATTGCAGGGTTTCTCGAGAAACCCTGCAATCGTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000181
VALIDATED
GUSB MISSION shRNA Lentiviral Transduction Particles
glucuronidase, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-574s21c1
Sequence:CCGGCCGAATCACTATCGCCATCAACTCGAGTTGATGGCGATAGTGATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-1657s21c1
Sequence:CCGGCTGGTATAAGAAGTATCAGAACTCGAGTTCTGATACTTCTTATACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-963s21c1
Sequence:CCGGGCCCTGCCTATCTGTATTCATCTCGAGATGAATACAGATAGGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-1994s21c1
Sequence:CCGGGCCAAGTCACAATGTTTGGAACTCGAGTTCCAAACATTGTGACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000181.1-1944s1c1
Sequence:CCGGGCCAAGTCACAATGTTTGGAACTCGAGTTCCAAACATTGTGACTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_000181.1-524s1c1
Sequence:CCGGCCGAATCACTATCGCCATCAACTCGAGTTGATGGCGATAGTGATTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000181.1-913s1c1
Sequence:CCGGGCCCTGCCTATCTGTATTCATCTCGAGATGAATACAGATAGGCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_000181.1-1607s1c1
Sequence:CCGGCTGGTATAAGAAGTATCAGAACTCGAGTTCTGATACTTCTTATACCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000181.1-1653s1c1
Sequence:CCGGGCAGAAACGATTGCAGGGTTTCTCGAGAAACCCTGCAATCGTTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000181.2-1703s21c1
Sequence:CCGGGCAGAAACGATTGCAGGGTTTCTCGAGAAACCCTGCAATCGTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010368
VALIDATED
GUSB MISSION shRNA Bacterial Glycerol Stock
glucuronidase, beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010368.1-1794s1c1
Sequence:CCGGGCTGAGAGTAATCGGAAACAACTCGAGTTGTTTCCGATTACTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010368.1-389s1c1
Sequence:CCGGCCCATTATTATGCAGTTGTGTCTCGAGACACAACTGCATAATAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010368.1-2198s1c1
Sequence:CCGGGTGTGAACATTCTCACTAAATCTCGAGATTTAGTGAGAATGTTCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010368.1-1758s1c1
Sequence:CCGGCTGGAATTTCGCCGACTTCATCTCGAGATGAAGTCGGCGAAATTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-1794s21c1
Sequence:CCGGGCTGAGAGTAATCGGAAACAACTCGAGTTGTTTCCGATTACTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-681s21c1
Sequence:CCGGTACCACTTACATCGATGATATCTCGAGATATCATCGATGTAAGTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-1590s21c1
Sequence:CCGGGACGCATCAGAAGCCGATTATCTCGAGATAATCGGCTTCTGATGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-1758s21c1
Sequence:CCGGCTGGAATTTCGCCGACTTCATCTCGAGATGAAGTCGGCGAAATTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-2198s21c1
Sequence:CCGGGTGTGAACATTCTCACTAAATCTCGAGATTTAGTGAGAATGTTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010368
VALIDATED
GUSB MISSION shRNA shRNA Plasmid DNA
glucuronidase, beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010368.1-1794s1c1
Sequence:CCGGGCTGAGAGTAATCGGAAACAACTCGAGTTGTTTCCGATTACTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010368.1-389s1c1
Sequence:CCGGCCCATTATTATGCAGTTGTGTCTCGAGACACAACTGCATAATAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010368.1-2198s1c1
Sequence:CCGGGTGTGAACATTCTCACTAAATCTCGAGATTTAGTGAGAATGTTCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010368.1-1758s1c1
Sequence:CCGGCTGGAATTTCGCCGACTTCATCTCGAGATGAAGTCGGCGAAATTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-1794s21c1
Sequence:CCGGGCTGAGAGTAATCGGAAACAACTCGAGTTGTTTCCGATTACTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-681s21c1
Sequence:CCGGTACCACTTACATCGATGATATCTCGAGATATCATCGATGTAAGTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-1590s21c1
Sequence:CCGGGACGCATCAGAAGCCGATTATCTCGAGATAATCGGCTTCTGATGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-1758s21c1
Sequence:CCGGCTGGAATTTCGCCGACTTCATCTCGAGATGAAGTCGGCGAAATTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-2198s21c1
Sequence:CCGGGTGTGAACATTCTCACTAAATCTCGAGATTTAGTGAGAATGTTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010368
VALIDATED
GUSB MISSION shRNA Lentiviral Transduction Particles
glucuronidase, beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010368.1-1794s1c1
Sequence:CCGGGCTGAGAGTAATCGGAAACAACTCGAGTTGTTTCCGATTACTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010368.1-389s1c1
Sequence:CCGGCCCATTATTATGCAGTTGTGTCTCGAGACACAACTGCATAATAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010368.1-2198s1c1
Sequence:CCGGGTGTGAACATTCTCACTAAATCTCGAGATTTAGTGAGAATGTTCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010368.1-1758s1c1
Sequence:CCGGCTGGAATTTCGCCGACTTCATCTCGAGATGAAGTCGGCGAAATTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-1794s21c1
Sequence:CCGGGCTGAGAGTAATCGGAAACAACTCGAGTTGTTTCCGATTACTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-681s21c1
Sequence:CCGGTACCACTTACATCGATGATATCTCGAGATATCATCGATGTAAGTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-1590s21c1
Sequence:CCGGGACGCATCAGAAGCCGATTATCTCGAGATAATCGGCTTCTGATGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-1758s21c1
Sequence:CCGGCTGGAATTTCGCCGACTTCATCTCGAGATGAAGTCGGCGAAATTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279400    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010368.1-2198s21c1
Sequence:CCGGGTGTGAACATTCTCACTAAATCTCGAGATTTAGTGAGAATGTTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)