EMAIL THIS PAGE TO A FRIEND

GUSBP11

glucuronidase, beta pseudogene 11

29 Gene Product Result for
Species: Human GUSBP11(91316)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_498877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_498877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_498877 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_038140 Rosetta Predictions human pricing
XR_040205 Rosetta Predictions human pricing
XR_040206 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_038140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00504913 predicted 263
2 SASI_Hs02_00504914 predicted 345
3 SASI_Hs02_00504915 predicted 266
4 SASI_Hs02_00504916 predicted 400
5 SASI_Hs02_00504917 predicted 663
6 SASI_Hs02_00504918 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516859 predicted 2126
2 SASI_Hs02_00516860 predicted 2123
3 SASI_Hs02_00516861 predicted 2145
4 SASI_Hs02_00516862 predicted 2325
5 SASI_Hs02_00516863 predicted 2353
6 SASI_Hs02_00516864 predicted 662
7 SASI_Hs02_00516865 predicted 2351
8 SASI_Hs02_00516866 predicted 2011
9 SASI_Hs02_00516867 predicted 2257
10 SASI_Hs02_00516868 predicted 2018
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516869 predicted 2127
2 SASI_Hs02_00516870 predicted 2120
3 SASI_Hs02_00516871 predicted 2143
4 SASI_Hs02_00516872 predicted 2324
5 SASI_Hs02_00516873 predicted 2348
6 SASI_Hs02_00516874 predicted 665
7 SASI_Hs02_00516875 predicted 2345
8 SASI_Hs02_00516876 predicted 2014
9 SASI_Hs02_00516877 predicted 2254
10 SASI_Hs02_00516878 predicted 2013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_498877
GUSBP11 MISSION shRNA Bacterial Glycerol Stock
glucuronidase, beta pseudogene 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_498877.1-707s1c1
Sequence:CCGGCAAGGGTTACTTTGTCCAGAACTCGAGTTCTGGACAAAGTAACCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-190s1c1
Sequence:CCGGGCAATCGCCCTCAACAAAGATCTCGAGATCTTTGTTGAGGGCGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-521s1c1
Sequence:CCGGCCCACCGTGGACATGCCGGTTCTCGAGAACCGGCATGTCCACGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-115s1c1
Sequence:CCGGCCCTGGATCATCCAGCACAGACTCGAGTCTGTGCTGGATGATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-368s1c1
Sequence:CCGGGCTGTTGTATGGCTGCACGTTCTCGAGAACGTGCAGCCATACAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_498877
GUSBP11 MISSION shRNA shRNA Plasmid DNA
glucuronidase, beta pseudogene 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_498877.1-707s1c1
Sequence:CCGGCAAGGGTTACTTTGTCCAGAACTCGAGTTCTGGACAAAGTAACCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-190s1c1
Sequence:CCGGGCAATCGCCCTCAACAAAGATCTCGAGATCTTTGTTGAGGGCGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-521s1c1
Sequence:CCGGCCCACCGTGGACATGCCGGTTCTCGAGAACCGGCATGTCCACGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-115s1c1
Sequence:CCGGCCCTGGATCATCCAGCACAGACTCGAGTCTGTGCTGGATGATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-368s1c1
Sequence:CCGGGCTGTTGTATGGCTGCACGTTCTCGAGAACGTGCAGCCATACAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_498877
GUSBP11 MISSION shRNA Lentiviral Transduction Particles
glucuronidase, beta pseudogene 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_498877.1-707s1c1
Sequence:CCGGCAAGGGTTACTTTGTCCAGAACTCGAGTTCTGGACAAAGTAACCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-190s1c1
Sequence:CCGGGCAATCGCCCTCAACAAAGATCTCGAGATCTTTGTTGAGGGCGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-521s1c1
Sequence:CCGGCCCACCGTGGACATGCCGGTTCTCGAGAACCGGCATGTCCACGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-115s1c1
Sequence:CCGGCCCTGGATCATCCAGCACAGACTCGAGTCTGTGCTGGATGATCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_498877.1-368s1c1
Sequence:CCGGGCTGTTGTATGGCTGCACGTTCTCGAGAACGTGCAGCCATACAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)