EMAIL THIS PAGE TO A FRIEND

GUSBP2

glucuronidase, beta pseudogene 2

21 Gene Product Result for
Synonyms: GUSBL1 GUSBP4 SMA3-L SMAC3L SMAC3L2 b55C20.1 bA239L20.1 bA239L20.5 bGLU-Lp
Species: Human GUSBP2(387036)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033523 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033523 Rosetta Predictions human pricing
NR_003504 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033359 predicted 686
2 SASI_Hs01_00033360 predicted 583
3 SASI_Hs01_00033361 predicted 708
4 SASI_Hs01_00033362 predicted 764
5 SASI_Hs01_00033363 predicted 712
6 SASI_Hs01_00033364 predicted 677
7 SASI_Hs01_00033365 predicted 814
8 SASI_Hs01_00033366 predicted 805
9 SASI_Hs01_00033367 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379337 predicted 870
2 SASI_Hs02_00379338 predicted 508
3 SASI_Hs02_00379339 predicted 783
4 SASI_Hs02_00379340 predicted 669
5 SASI_Hs02_00379341 predicted 835
6 SASI_Hs02_00379342 predicted 797
7 SASI_Hs02_00379343 predicted 679
8 SASI_Hs02_00379344 predicted 917
9 SASI_Hs02_00379345 predicted 695
10 SASI_Hs02_00379346 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033523
GUSBP2 MISSION shRNA Bacterial Glycerol Stock
glucuronidase, beta pseudogene 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-394s1c1
Sequence:CCGGCAGGCTGGTGAATTACCAGATCTCGAGATCTGGTAATTCACCAGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033523.1-809s1c1
Sequence:CCGGCGTATGGAGTGGAAACGCTTACTCGAGTAAGCGTTTCCACTCCATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-686s1c1
Sequence:CCGGGATCCGTGTGAACAGCTACTACTCGAGTAGTAGCTGTTCACACGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-418s1c1
Sequence:CCGGCGTCAAGTGCAGTAACCAGTTCTCGAGAACTGGTTACTGCACTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-412s1c1
Sequence:CCGGGATCTCCGTCAAGTGCAGTAACTCGAGTTACTGCACTTGACGGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-584s1c1
Sequence:CCGGGATGGTGATTGCTCACACCAACTCGAGTTGGTGTGAGCAATCACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033523.1-778s1c1
Sequence:CCGGGTAAGACATCACAATCCCATTCTCGAGAATGGGATTGTGATGTCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-590s1c1
Sequence:CCGGGATTGCTCACACCAAAGCCTTCTCGAGAAGGCTTTGGTGTGAGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033523
GUSBP2 MISSION shRNA shRNA Plasmid DNA
glucuronidase, beta pseudogene 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-394s1c1
Sequence:CCGGCAGGCTGGTGAATTACCAGATCTCGAGATCTGGTAATTCACCAGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033523.1-809s1c1
Sequence:CCGGCGTATGGAGTGGAAACGCTTACTCGAGTAAGCGTTTCCACTCCATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-686s1c1
Sequence:CCGGGATCCGTGTGAACAGCTACTACTCGAGTAGTAGCTGTTCACACGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-418s1c1
Sequence:CCGGCGTCAAGTGCAGTAACCAGTTCTCGAGAACTGGTTACTGCACTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-412s1c1
Sequence:CCGGGATCTCCGTCAAGTGCAGTAACTCGAGTTACTGCACTTGACGGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-584s1c1
Sequence:CCGGGATGGTGATTGCTCACACCAACTCGAGTTGGTGTGAGCAATCACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033523.1-778s1c1
Sequence:CCGGGTAAGACATCACAATCCCATTCTCGAGAATGGGATTGTGATGTCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-590s1c1
Sequence:CCGGGATTGCTCACACCAAAGCCTTCTCGAGAAGGCTTTGGTGTGAGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033523
GUSBP2 MISSION shRNA Lentiviral Transduction Particles
glucuronidase, beta pseudogene 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-394s1c1
Sequence:CCGGCAGGCTGGTGAATTACCAGATCTCGAGATCTGGTAATTCACCAGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033523.1-809s1c1
Sequence:CCGGCGTATGGAGTGGAAACGCTTACTCGAGTAAGCGTTTCCACTCCATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-686s1c1
Sequence:CCGGGATCCGTGTGAACAGCTACTACTCGAGTAGTAGCTGTTCACACGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-418s1c1
Sequence:CCGGCGTCAAGTGCAGTAACCAGTTCTCGAGAACTGGTTACTGCACTTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-412s1c1
Sequence:CCGGGATCTCCGTCAAGTGCAGTAACTCGAGTTACTGCACTTGACGGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-584s1c1
Sequence:CCGGGATGGTGATTGCTCACACCAACTCGAGTTGGTGTGAGCAATCACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151124    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033523.1-778s1c1
Sequence:CCGGGTAAGACATCACAATCCCATTCTCGAGAATGGGATTGTGATGTCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033523.1-590s1c1
Sequence:CCGGGATTGCTCACACCAAAGCCTTCTCGAGAAGGCTTTGGTGTGAGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)