EMAIL THIS PAGE TO A FRIEND

GUSBP4

glucuronidase, beta pseudogene 4

24 Gene Product Result for
Synonyms: C6orf216 GUSBL2 SMA3-L SMAC3L b55C20.2
Species: Human GUSBP4(375513)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206910 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206908 Rosetta Predictions human pricing
NM_206910 Rosetta Predictions human pricing
NM_206911 Rosetta Predictions human pricing
NM_206912 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034834 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165536 predicted 611
2 SASI_Hs01_00165537 predicted 659
3 SASI_Hs01_00165538 predicted 653
4 SASI_Hs01_00165539 predicted 573
5 SASI_Hs01_00165540 predicted 459
6 SASI_Hs01_00165541 predicted 564
7 SASI_Hs01_00165542 predicted 606
8 SASI_Hs01_00165543 predicted 552
9 SASI_Hs01_00165544 predicted 553
10 SASI_Hs01_00165545 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183160 predicted 577
2 SASI_Hs01_00183161 predicted 554
3 SASI_Hs01_00183162 predicted 583
4 SASI_Hs01_00183163 predicted 552
5 SASI_Hs01_00183164 predicted 508
6 SASI_Hs01_00183165 predicted 500
7 SASI_Hs01_00183166 predicted 538
8 SASI_Hs01_00183167 predicted 455
9 SASI_Hs01_00183168 predicted 301
10 SASI_Hs01_00183169 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238865 predicted 499
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206910
GUSBP4 MISSION shRNA Bacterial Glycerol Stock
glucuronidase, beta pseudogene 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166794    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-1232s1c1
Sequence:CCGGCCTCAGGCTGTTTCTGCAATTCTCGAGAATTGCAGAAACAGCCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-737s1c1
Sequence:CCGGGCCTTAAGGAATAAGAGGAAACTCGAGTTTCCTCTTATTCCTTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-601s1c1
Sequence:CCGGGTCTCAAAGAATCTACGGAATCTCGAGATTCCGTAGATTCTTTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-980s1c1
Sequence:CCGGGCCTGTCATCATTTGAAAGTACTCGAGTACTTTCAAATGATGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-201s1c1
Sequence:CCGGGCAATGTTTGAACAAACTCAACTCGAGTTGAGTTTGTTCAAACATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-938s1c1
Sequence:CCGGGCAGCACTTGAAGAGAGGTTTCTCGAGAAACCTCTCTTCAAGTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161995    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-556s1c1
Sequence:CCGGGCAGTTCAACCCAATGGAAATCTCGAGATTTCCATTGGGTTGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-180s1c1
Sequence:CCGGGCTCACACATTTGACTTGGAACTCGAGTTCCAAGTCAAATGTGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-981s1c1
Sequence:CCGGCCTGTCATCATTTGAAAGTAACTCGAGTTACTTTCAAATGATGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-1428s1c1
Sequence:CCGGGCCATTTCATACCCAATGCATCTCGAGATGCATTGGGTATGAAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206910
GUSBP4 MISSION shRNA shRNA Plasmid DNA
glucuronidase, beta pseudogene 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166794    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-1232s1c1
Sequence:CCGGCCTCAGGCTGTTTCTGCAATTCTCGAGAATTGCAGAAACAGCCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-737s1c1
Sequence:CCGGGCCTTAAGGAATAAGAGGAAACTCGAGTTTCCTCTTATTCCTTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-601s1c1
Sequence:CCGGGTCTCAAAGAATCTACGGAATCTCGAGATTCCGTAGATTCTTTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-980s1c1
Sequence:CCGGGCCTGTCATCATTTGAAAGTACTCGAGTACTTTCAAATGATGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-201s1c1
Sequence:CCGGGCAATGTTTGAACAAACTCAACTCGAGTTGAGTTTGTTCAAACATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-938s1c1
Sequence:CCGGGCAGCACTTGAAGAGAGGTTTCTCGAGAAACCTCTCTTCAAGTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161995    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-556s1c1
Sequence:CCGGGCAGTTCAACCCAATGGAAATCTCGAGATTTCCATTGGGTTGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-180s1c1
Sequence:CCGGGCTCACACATTTGACTTGGAACTCGAGTTCCAAGTCAAATGTGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-981s1c1
Sequence:CCGGCCTGTCATCATTTGAAAGTAACTCGAGTTACTTTCAAATGATGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-1428s1c1
Sequence:CCGGGCCATTTCATACCCAATGCATCTCGAGATGCATTGGGTATGAAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206910
GUSBP4 MISSION shRNA Lentiviral Transduction Particles
glucuronidase, beta pseudogene 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166794    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-1232s1c1
Sequence:CCGGCCTCAGGCTGTTTCTGCAATTCTCGAGAATTGCAGAAACAGCCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-737s1c1
Sequence:CCGGGCCTTAAGGAATAAGAGGAAACTCGAGTTTCCTCTTATTCCTTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-601s1c1
Sequence:CCGGGTCTCAAAGAATCTACGGAATCTCGAGATTCCGTAGATTCTTTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-980s1c1
Sequence:CCGGGCCTGTCATCATTTGAAAGTACTCGAGTACTTTCAAATGATGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159442    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-201s1c1
Sequence:CCGGGCAATGTTTGAACAAACTCAACTCGAGTTGAGTTTGTTCAAACATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-938s1c1
Sequence:CCGGGCAGCACTTGAAGAGAGGTTTCTCGAGAAACCTCTCTTCAAGTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161995    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-556s1c1
Sequence:CCGGGCAGTTCAACCCAATGGAAATCTCGAGATTTCCATTGGGTTGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160896    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-180s1c1
Sequence:CCGGGCTCACACATTTGACTTGGAACTCGAGTTCCAAGTCAAATGTGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206910.1-981s1c1
Sequence:CCGGCCTGTCATCATTTGAAAGTAACTCGAGTTACTTTCAAATGATGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_206910.1-1428s1c1
Sequence:CCGGGCCATTTCATACCCAATGCATCTCGAGATGCATTGGGTATGAAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)