EMAIL THIS PAGE TO A FRIEND

GUSBP5

glucuronidase, beta pseudogene 5

22 Gene Product Result for
Synonyms: GYPELOC441046
Species: Human GUSBP5(441046)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011539 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011539 Rosetta Predictions human pricing
NR_003675 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060789 predicted 373
2 SASI_Hs01_00060790 predicted 265
3 SASI_Hs01_00060791 predicted 582
4 SASI_Hs01_00060792 predicted 373
5 SASI_Hs01_00060793 predicted 360
6 SASI_Hs01_00060794 predicted 536
7 SASI_Hs01_00060795 predicted 660
8 SASI_Hs01_00060796 predicted 1096
9 SASI_Hs01_00060797 predicted 1102
10 SASI_Hs01_00060798 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380084 predicted 1646
2 SASI_Hs02_00380085 predicted 1676
3 SASI_Hs02_00380086 predicted 1677
4 SASI_Hs02_00380087 predicted 1683
5 SASI_Hs02_00380088 predicted 1638
6 SASI_Hs02_00380089 predicted 1679
7 SASI_Hs02_00380090 predicted 1632
8 SASI_Hs02_00380091 predicted 1613
9 SASI_Hs02_00380092 predicted 212
10 SASI_Hs02_00380093 predicted 1625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011539
GUSBP5 MISSION shRNA Bacterial Glycerol Stock
glucuronidase, beta pseudogene 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-457s1c1
Sequence:CCGGCCTTTGACACCGACATCAGTACTCGAGTACTGATGTCGGTGTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-515s1c1
Sequence:CCGGCATCACTATCACCATCGGCAACTCGAGTTGCCGATGGTGATAGTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-518s1c1
Sequence:CCGGCACTATCACCATCGGCAACATCTCGAGATGTTGCCGATGGTGATAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159241    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1424s1c1
Sequence:CCGGGCAATATTTGATGTAGCCAATCTCGAGATTGGCTACATCAAATATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1206s1c1
Sequence:CCGGGCATTGGATTTAATGACTGATCTCGAGATCAGTCATTAAATCCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1717s1c1
Sequence:CCGGGCTCTAGTAGTTTCTTCAGATCTCGAGATCTGAAGAAACTACTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1702s1c1
Sequence:CCGGCCTGAATTATTGTTGGCTCTACTCGAGTAGAGCCAACAATAATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-368s1c1
Sequence:CCGGGAGTGGTACTGAGGATTGTCACTCGAGTGACAATCCTCAGTACCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011539
GUSBP5 MISSION shRNA shRNA Plasmid DNA
glucuronidase, beta pseudogene 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-457s1c1
Sequence:CCGGCCTTTGACACCGACATCAGTACTCGAGTACTGATGTCGGTGTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-515s1c1
Sequence:CCGGCATCACTATCACCATCGGCAACTCGAGTTGCCGATGGTGATAGTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-518s1c1
Sequence:CCGGCACTATCACCATCGGCAACATCTCGAGATGTTGCCGATGGTGATAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159241    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1424s1c1
Sequence:CCGGGCAATATTTGATGTAGCCAATCTCGAGATTGGCTACATCAAATATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1206s1c1
Sequence:CCGGGCATTGGATTTAATGACTGATCTCGAGATCAGTCATTAAATCCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1717s1c1
Sequence:CCGGGCTCTAGTAGTTTCTTCAGATCTCGAGATCTGAAGAAACTACTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1702s1c1
Sequence:CCGGCCTGAATTATTGTTGGCTCTACTCGAGTAGAGCCAACAATAATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-368s1c1
Sequence:CCGGGAGTGGTACTGAGGATTGTCACTCGAGTGACAATCCTCAGTACCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011539
GUSBP5 MISSION shRNA Lentiviral Transduction Particles
glucuronidase, beta pseudogene 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-457s1c1
Sequence:CCGGCCTTTGACACCGACATCAGTACTCGAGTACTGATGTCGGTGTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-515s1c1
Sequence:CCGGCATCACTATCACCATCGGCAACTCGAGTTGCCGATGGTGATAGTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-518s1c1
Sequence:CCGGCACTATCACCATCGGCAACATCTCGAGATGTTGCCGATGGTGATAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159241    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1424s1c1
Sequence:CCGGGCAATATTTGATGTAGCCAATCTCGAGATTGGCTACATCAAATATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1206s1c1
Sequence:CCGGGCATTGGATTTAATGACTGATCTCGAGATCAGTCATTAAATCCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161577    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1717s1c1
Sequence:CCGGGCTCTAGTAGTTTCTTCAGATCTCGAGATCTGAAGAAACTACTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162693    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011539.1-1702s1c1
Sequence:CCGGCCTGAATTATTGTTGGCTCTACTCGAGTAGAGCCAACAATAATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011539.1-368s1c1
Sequence:CCGGGAGTGGTACTGAGGATTGTCACTCGAGTGACAATCCTCAGTACCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)