EMAIL THIS PAGE TO A FRIEND

GVINP1

GTPase, very large interferon inducible pseudogene 1

53 Gene Product Result for
Synonyms: GVIN1 GVIN1P VLIG-1 VLIG1
UniProtKB ID: Q7Z2Y8, A6NFL2, Q9H8N5
Gene ID:
Rat(293347) GTPase, very large interferon inducible 1
chicken(428660) GTPase, very large interferon inducible pseudogene 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_495863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_495863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_495863 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003945 Rosetta Predictions human pricing
XM_495863 Rosetta Predictions human pricing
XM_001075523 Rosetta Predictions rat pricing
XM_219130 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380664 predicted 3474
2 SASI_Hs02_00380665 predicted 1991
3 SASI_Hs02_00380666 predicted 3451
4 SASI_Hs02_00380667 predicted 2842
5 SASI_Hs02_00380668 predicted 5779
6 SASI_Hs02_00380669 predicted 6164
7 SASI_Hs02_00380670 predicted 4813
8 SASI_Hs02_00380671 predicted 4549
9 SASI_Hs02_00380672 predicted 4517
10 SASI_Hs02_00380673 predicted 6191
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_495863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248201 predicted 3481
2 SASI_Hs01_00248202 predicted 1999
3 SASI_Hs01_00248203 predicted 1038
4 SASI_Hs01_00248204 predicted 3458
5 SASI_Hs01_00248205 predicted 2853
6 SASI_Hs01_00248206 predicted 5791
7 SASI_Hs01_00248207 predicted 4820
8 SASI_Hs01_00248208 predicted 4556
9 SASI_Hs01_00248209 predicted 4527
10 SASI_Hs01_00248210 predicted 6189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075523 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350043 predicted 2953
2 SASI_Rn02_00350044 predicted 2151
3 SASI_Rn02_00350045 predicted 6126
4 SASI_Rn02_00350046 predicted 5632
5 SASI_Rn02_00350047 predicted 2269
6 SASI_Rn02_00350048 predicted 5623
7 SASI_Rn02_00350049 predicted 1181
8 SASI_Rn02_00350050 predicted 5976
9 SASI_Rn02_00350051 predicted 5926
10 SASI_Rn02_00350052 predicted 2742
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378297 predicted 2953
2 SASI_Rn02_00378298 predicted 2157
3 SASI_Rn02_00378299 predicted 6126
4 SASI_Rn02_00378300 predicted 5634
5 SASI_Rn02_00378301 predicted 2262
6 SASI_Rn02_00378302 predicted 5621
7 SASI_Rn02_00378303 predicted 1185
8 SASI_Rn02_00378304 predicted 5981
9 SASI_Rn02_00378305 predicted 5922
10 SASI_Rn02_00378306 predicted 2736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_495863
GVINP1 MISSION shRNA Bacterial Glycerol Stock
GTPase, very large interferon inducible pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-5815s1c1
Sequence:CCGGGCAGAGAAGTTTCAAATCAATCTCGAGATTGATTTGAAACTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-3558s1c1
Sequence:CCGGCCAAAGAATGAGAATGGGTATCTCGAGATACCCATTCTCATTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-148s1c1
Sequence:CCGGGCCTTACAACACCTAGACAAACTCGAGTTTGTCTAGGTGTTGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-3014s1c1
Sequence:CCGGCCTGTACTTCTCAGATTGAATCTCGAGATTCAATCTGAGAAGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-787s1c1
Sequence:CCGGGCTGGTTTGGATCACAGCAAACTCGAGTTTGCTGTGATCCAAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_495863
GVINP1 MISSION shRNA shRNA Plasmid DNA
GTPase, very large interferon inducible pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-5815s1c1
Sequence:CCGGGCAGAGAAGTTTCAAATCAATCTCGAGATTGATTTGAAACTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-3558s1c1
Sequence:CCGGCCAAAGAATGAGAATGGGTATCTCGAGATACCCATTCTCATTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-148s1c1
Sequence:CCGGGCCTTACAACACCTAGACAAACTCGAGTTTGTCTAGGTGTTGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-3014s1c1
Sequence:CCGGCCTGTACTTCTCAGATTGAATCTCGAGATTCAATCTGAGAAGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-787s1c1
Sequence:CCGGGCTGGTTTGGATCACAGCAAACTCGAGTTTGCTGTGATCCAAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_495863
GVINP1 MISSION shRNA Lentiviral Transduction Particles
GTPase, very large interferon inducible pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-5815s1c1
Sequence:CCGGGCAGAGAAGTTTCAAATCAATCTCGAGATTGATTTGAAACTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-3558s1c1
Sequence:CCGGCCAAAGAATGAGAATGGGTATCTCGAGATACCCATTCTCATTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-148s1c1
Sequence:CCGGGCCTTACAACACCTAGACAAACTCGAGTTTGTCTAGGTGTTGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-3014s1c1
Sequence:CCGGCCTGTACTTCTCAGATTGAATCTCGAGATTCAATCTGAGAAGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495863.1-787s1c1
Sequence:CCGGGCTGGTTTGGATCACAGCAAACTCGAGTTTGCTGTGATCCAAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)