EMAIL THIS PAGE TO A FRIEND

GXYLT1

glucoside xylosyltransferase 1

228 Gene Product Result for
Synonyms: GLT8D3
UniProtKB ID: Q4G148, B3KWJ2, Q8IXV1, Q96BH4
Gene ID:
Human(283464) Summary: GXYLT1 is a xylosyltransferase (EC 2.4.2.-) that adds the first xylose to O-glucose-modified residues in the epidermal growth factor (EGF; MIM 131530) repeats of proteins such as NOTCH1 (MIM 190198) (Sethi et al., 2010 [PubMed 19940119]
Mouse(223827) glucoside xylosyltransferase 1
Rat(300173) glucoside xylosyltransferase 1
chicken(417789) glucoside xylosyltransferase 1
domestic cat(101099221) glucoside xylosyltransferase 1
cow(617596) glucoside xylosyltransferase 1
Horse(100054009) glucoside xylosyltransferase 1
dog(486604) glucoside xylosyltransferase 1
sheep(101110670) glucoside xylosyltransferase 1
domestic guinea pig(100716393) glucoside xylosyltransferase 1
naked mole-rat(101720209) glucoside xylosyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302009 ANTI-GLT8D3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099650 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099650 Rosetta Predictions human pricing
NM_173601 Rosetta Predictions human pricing
XM_290597 Rosetta Predictions human pricing
XM_001057023 Rosetta Predictions rat pricing
XM_001057074 Rosetta Predictions rat pricing
XM_217027 Rosetta Predictions rat pricing
NM_001033275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320873 predicted 931
2 SASI_Hs02_00320874 predicted 1130
3 SASI_Hs02_00320875 predicted 1307
4 SASI_Hs02_00320876 predicted 1221
5 SASI_Hs02_00320877 predicted 1232
6 SASI_Hs02_00320878 predicted 932
7 SASI_Hs02_00320879 predicted 1299
8 SASI_Hs02_00320880 predicted 1139
9 SASI_Hs02_00320881 predicted 899
10 SASI_Hs02_00320882 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368452 predicted 1025
2 SASI_Hs02_00368453 predicted 1225
3 SASI_Hs02_00368454 predicted 1403
4 SASI_Hs02_00368455 predicted 1310
5 SASI_Hs02_00368456 predicted 1324
6 SASI_Hs02_00368457 predicted 1028
7 SASI_Hs02_00368458 predicted 1399
8 SASI_Hs02_00368459 predicted 1233
9 SASI_Hs02_00368460 predicted 997
10 SASI_Hs02_00368461 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251328 predicted 1295
2 SASI_Hs01_00251329 predicted 1345
3 SASI_Hs01_00251330 predicted 1338
4 SASI_Hs01_00251331 predicted 1344
5 SASI_Hs01_00251332 predicted 1227
6 SASI_Hs01_00251333 predicted 1262
7 SASI_Hs01_00251334 predicted 1344
8 SASI_Hs01_00251335 predicted 1342
9 SASI_Hs01_00251336 predicted 1290
10 SASI_Hs01_00251337 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057023 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285167 predicted 252
2 SASI_Rn02_00285168 predicted 1155
3 SASI_Rn02_00285169 predicted 358
4 SASI_Rn02_00285170 predicted 245
5 SASI_Rn02_00285171 predicted 801
6 SASI_Rn02_00285172 predicted 1123
7 SASI_Rn02_00285173 predicted 486
8 SASI_Rn02_00285174 predicted 923
9 SASI_Rn02_00285175 predicted 967
10 SASI_Rn02_00285176 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285346 predicted 496
2 SASI_Rn02_00285347 predicted 1405
3 SASI_Rn02_00285348 predicted 262
4 SASI_Rn02_00285349 predicted 486
5 SASI_Rn02_00285350 predicted 1048
6 SASI_Rn02_00285351 predicted 1362
7 SASI_Rn02_00285352 predicted 730
8 SASI_Rn02_00285353 predicted 1163
9 SASI_Rn02_00285354 predicted 1212
10 SASI_Rn02_00285355 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376960 predicted 1690
2 SASI_Rn02_00376961 predicted 1171
3 SASI_Rn02_00376962 predicted 1639
4 SASI_Rn02_00376963 predicted 1335
5 SASI_Rn02_00376964 predicted 1023
6 SASI_Rn02_00376965 predicted 1692
7 SASI_Rn02_00376966 predicted 1457
8 SASI_Rn02_00376967 predicted 1509
9 SASI_Rn02_00376968 predicted 1672
10 SASI_Rn02_00376969 predicted 1635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113175 predicted 359
2 SASI_Mm01_00113176 predicted 742
3 SASI_Mm01_00113177 predicted 748
4 SASI_Mm01_00113178 predicted 510
5 SASI_Mm01_00113179 predicted 243
6 SASI_Mm01_00113180 predicted 338
7 SASI_Mm01_00113181 predicted 989
8 SASI_Mm01_00113182 predicted 495
9 SASI_Mm01_00113183 predicted 422
10 SASI_Mm01_00113184 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099650
VALIDATED
GXYLT1 MISSION shRNA Bacterial Glycerol Stock
glucoside xylosyltransferase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099650.1-883s21c1
Sequence:CCGGCCTCGAATAGGATGGTATAATCTCGAGATTATACCATCCTATTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099650.1-2640s21c1
Sequence:CCGGCTTGACCTGTTAGCTAATATACTCGAGTATATTAGCTAACAGGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099650.1-616s21c1
Sequence:CCGGAGACTTGACAACTGGTCATTTCTCGAGAAATGACCAGTTGTCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099650.1-730s21c1
Sequence:CCGGAGATTGTTCTTGCCGTTAATCCTCGAGGATTAACGGCAAGAACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099650.1-906s21c1
Sequence:CCGGCTTTGCTAGGCATCCATATTACTCGAGTAATATGGATGCCTAGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099650
VALIDATED
GXYLT1 MISSION shRNA shRNA Plasmid DNA
glucoside xylosyltransferase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099650.1-883s21c1
Sequence:CCGGCCTCGAATAGGATGGTATAATCTCGAGATTATACCATCCTATTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099650.1-2640s21c1
Sequence:CCGGCTTGACCTGTTAGCTAATATACTCGAGTATATTAGCTAACAGGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099650.1-616s21c1
Sequence:CCGGAGACTTGACAACTGGTCATTTCTCGAGAAATGACCAGTTGTCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099650.1-730s21c1
Sequence:CCGGAGATTGTTCTTGCCGTTAATCCTCGAGGATTAACGGCAAGAACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099650.1-906s21c1
Sequence:CCGGCTTTGCTAGGCATCCATATTACTCGAGTAATATGGATGCCTAGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099650
VALIDATED
GXYLT1 MISSION shRNA Lentiviral Transduction Particles
glucoside xylosyltransferase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099650.1-883s21c1
Sequence:CCGGCCTCGAATAGGATGGTATAATCTCGAGATTATACCATCCTATTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099650.1-2640s21c1
Sequence:CCGGCTTGACCTGTTAGCTAATATACTCGAGTATATTAGCTAACAGGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099650.1-616s21c1
Sequence:CCGGAGACTTGACAACTGGTCATTTCTCGAGAAATGACCAGTTGTCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099650.1-730s21c1
Sequence:CCGGAGATTGTTCTTGCCGTTAATCCTCGAGGATTAACGGCAAGAACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099650.1-906s21c1
Sequence:CCGGCTTTGCTAGGCATCCATATTACTCGAGTAATATGGATGCCTAGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033275
VALIDATED
GXYLT1 MISSION shRNA Bacterial Glycerol Stock
glucoside xylosyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033275.4-2929s21c1
Sequence:CCGGATCCGTTGGCTGACGTGATATCTCGAGATATCACGTCAGCCAACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033275.4-563s21c1
Sequence:CCGGTACGACCTGTTGATGATATTTCTCGAGAAATATCATCAACAGGTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033275.4-646s21c1
Sequence:CCGGCCCAGAATTGGATGGTATAATCTCGAGATTATACCATCCAATTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033275.4-391s21c1
Sequence:CCGGTGGTCCTTCCTGCGGAGATTTCTCGAGAAATCTCCGCAGGAAGGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033275.4-918s21c1
Sequence:CCGGCCGACCAGATCACTGTATATACTCGAGTATATACAGTGATCTGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033275
VALIDATED
GXYLT1 MISSION shRNA shRNA Plasmid DNA
glucoside xylosyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033275.4-2929s21c1
Sequence:CCGGATCCGTTGGCTGACGTGATATCTCGAGATATCACGTCAGCCAACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033275.4-563s21c1
Sequence:CCGGTACGACCTGTTGATGATATTTCTCGAGAAATATCATCAACAGGTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033275.4-646s21c1
Sequence:CCGGCCCAGAATTGGATGGTATAATCTCGAGATTATACCATCCAATTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033275.4-391s21c1
Sequence:CCGGTGGTCCTTCCTGCGGAGATTTCTCGAGAAATCTCCGCAGGAAGGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033275.4-918s21c1
Sequence:CCGGCCGACCAGATCACTGTATATACTCGAGTATATACAGTGATCTGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033275
VALIDATED
GXYLT1 MISSION shRNA Lentiviral Transduction Particles
glucoside xylosyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033275.4-2929s21c1
Sequence:CCGGATCCGTTGGCTGACGTGATATCTCGAGATATCACGTCAGCCAACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033275.4-563s21c1
Sequence:CCGGTACGACCTGTTGATGATATTTCTCGAGAAATATCATCAACAGGTCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033275.4-646s21c1
Sequence:CCGGCCCAGAATTGGATGGTATAATCTCGAGATTATACCATCCAATTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033275.4-391s21c1
Sequence:CCGGTGGTCCTTCCTGCGGAGATTTCTCGAGAAATCTCCGCAGGAAGGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033275.4-918s21c1
Sequence:CCGGCCGACCAGATCACTGTATATACTCGAGTATATACAGTGATCTGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)