EMAIL THIS PAGE TO A FRIEND

GXYLT2

glucoside xylosyltransferase 2

42 Gene Product Result for
Synonyms: GLT8D4
UniProtKB ID: A0PJZ3
Gene ID:
Human(727936) Summary: GXYLT2 is a xylosyltransferase (EC 2.4.2.-) that adds the first xylose to O-glucose-modified residues in the epidermal growth factor (EGF; MIM 131530) repeats of proteins such as NOTCH1 (MIM 190198) (Sethi et al., 2010 [PubMed 19940119]
Mouse(232313) glucoside xylosyltransferase 2
Rat(688618) glucoside xylosyltransferase 2
Zebrafish(567541) glucoside xylosyltransferase 2
cow(507299) glucoside xylosyltransferase 2
Horse(100061938) glucoside xylosyltransferase 2
domestic cat(101094332) glucoside xylosyltransferase 2
dog(610815) glucoside xylosyltransferase 2
chicken(416097) glucoside xylosyltransferase 2
domestic guinea pig(100730100) glucoside xylosyltransferase 2
naked mole-rat(101726179) glucoside xylosyltransferase 2
sheep(101104350) glucoside xylosyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080393 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080393 Rosetta Predictions human pricing
XM_001066466 Rosetta Predictions rat pricing
NM_198612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314421 predicted 1214
2 SASI_Hs02_00314422 predicted 1200
3 SASI_Hs02_00314423 predicted 1224
4 SASI_Hs02_00314424 predicted 638
5 SASI_Hs02_00314425 predicted 1275
6 SASI_Hs02_00314426 predicted 678
7 SASI_Hs02_00314427 predicted 1216
8 SASI_Hs02_00314428 predicted 1273
9 SASI_Hs02_00314429 predicted 444
10 SASI_Hs02_00314430 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317534 predicted 816
2 SASI_Rn02_00317535 predicted 940
3 SASI_Rn02_00317536 predicted 406
4 SASI_Rn02_00317537 predicted 722
5 SASI_Rn02_00317538 predicted 494
6 SASI_Rn02_00317539 predicted 584
7 SASI_Rn02_00317540 predicted 826
8 SASI_Rn02_00317541 predicted 600
9 SASI_Rn02_00317542 predicted 480
10 SASI_Rn02_00317543 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080331 predicted 1008
2 SASI_Mm01_00080332 predicted 1196
3 SASI_Mm02_00351031 predicted 553
4 SASI_Mm01_00080339 predicted 522
5 SASI_Mm01_00080335 predicted 1224
6 SASI_Mm01_00080336 predicted 923
7 SASI_Mm01_00080337 predicted 621
8 SASI_Mm01_00080338 predicted 1274
9 SASI_Mm01_00080340 predicted 472
10 SASI_Mm02_00351032 predicted 926
11 SASI_Mm01_00080333 predicted 1271
12 SASI_Mm01_00080334 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080393
VALIDATED
GXYLT2 MISSION shRNA Bacterial Glycerol Stock
glucoside xylosyltransferase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-782s21c1
Sequence:CCGGATGGCTCTGCAGGAGTTAATTCTCGAGAATTAACTCCTGCAGAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-368s21c1
Sequence:CCGGAGACGCTGGTCATGCTCAAATCTCGAGATTTGAGCATGACCAGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-1338s21c1
Sequence:CCGGTTGTCTTGTTGCAAGTCAATTCTCGAGAATTGACTTGCAACAAGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-474s21c1
Sequence:CCGGCCAGTGGCCTGACTCATATACCTCGAGGTATATGAGTCAGGCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-587s21c1
Sequence:CCGGGACTCTTTCTTCCGGTGATTTCTCGAGAAATCACCGGAAGAAAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080393
VALIDATED
GXYLT2 MISSION shRNA shRNA Plasmid DNA
glucoside xylosyltransferase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-782s21c1
Sequence:CCGGATGGCTCTGCAGGAGTTAATTCTCGAGAATTAACTCCTGCAGAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-368s21c1
Sequence:CCGGAGACGCTGGTCATGCTCAAATCTCGAGATTTGAGCATGACCAGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-1338s21c1
Sequence:CCGGTTGTCTTGTTGCAAGTCAATTCTCGAGAATTGACTTGCAACAAGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-474s21c1
Sequence:CCGGCCAGTGGCCTGACTCATATACCTCGAGGTATATGAGTCAGGCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-587s21c1
Sequence:CCGGGACTCTTTCTTCCGGTGATTTCTCGAGAAATCACCGGAAGAAAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080393
VALIDATED
GXYLT2 MISSION shRNA Lentiviral Transduction Particles
glucoside xylosyltransferase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-782s21c1
Sequence:CCGGATGGCTCTGCAGGAGTTAATTCTCGAGAATTAACTCCTGCAGAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-368s21c1
Sequence:CCGGAGACGCTGGTCATGCTCAAATCTCGAGATTTGAGCATGACCAGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-1338s21c1
Sequence:CCGGTTGTCTTGTTGCAAGTCAATTCTCGAGAATTGACTTGCAACAAGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-474s21c1
Sequence:CCGGCCAGTGGCCTGACTCATATACCTCGAGGTATATGAGTCAGGCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080393.1-587s21c1
Sequence:CCGGGACTCTTTCTTCCGGTGATTTCTCGAGAAATCACCGGAAGAAAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198612
VALIDATED
GXYLT2 MISSION shRNA Bacterial Glycerol Stock
glucoside xylosyltransferase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198612.2-791s1c1
Sequence:CCGGGAAGCTTCTGAGGCAGTTTAACTCGAGTTAAACTGCCTCAGAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-1480s1c1
Sequence:CCGGGCTGCCTGGATATTTGTGTGTCTCGAGACACACAAATATCCAGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-1367s1c1
Sequence:CCGGCAAGCAAATTGAGAAGACGATCTCGAGATCGTCTTCTCAATTTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-563s1c1
Sequence:CCGGGCCCGAATTTGATAAACAGTTCTCGAGAACTGTTTATCAAATTCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198612.1-944s1c1
Sequence:CCGGCATAAGAAATACCCAGTTCAACTCGAGTTGAACTGGGTATTTCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-1128s1c1
Sequence:CCGGCCTGACCATTGCATGTATGGACTCGAGTCCATACATGCAATGGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198612.1-1085s1c1
Sequence:CCGGCCCAGAGTGTCTCTATGTGTTCTCGAGAACACATAGAGACACTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198612.1-927s1c1
Sequence:CCGGCTCATGAACTTGACTCGCATACTCGAGTATGCGAGTCAAGTTCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198612
VALIDATED
GXYLT2 MISSION shRNA shRNA Plasmid DNA
glucoside xylosyltransferase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198612.2-791s1c1
Sequence:CCGGGAAGCTTCTGAGGCAGTTTAACTCGAGTTAAACTGCCTCAGAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-1480s1c1
Sequence:CCGGGCTGCCTGGATATTTGTGTGTCTCGAGACACACAAATATCCAGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-1367s1c1
Sequence:CCGGCAAGCAAATTGAGAAGACGATCTCGAGATCGTCTTCTCAATTTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-563s1c1
Sequence:CCGGGCCCGAATTTGATAAACAGTTCTCGAGAACTGTTTATCAAATTCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198612.1-944s1c1
Sequence:CCGGCATAAGAAATACCCAGTTCAACTCGAGTTGAACTGGGTATTTCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-1128s1c1
Sequence:CCGGCCTGACCATTGCATGTATGGACTCGAGTCCATACATGCAATGGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198612.1-1085s1c1
Sequence:CCGGCCCAGAGTGTCTCTATGTGTTCTCGAGAACACATAGAGACACTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198612.1-927s1c1
Sequence:CCGGCTCATGAACTTGACTCGCATACTCGAGTATGCGAGTCAAGTTCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198612
VALIDATED
GXYLT2 MISSION shRNA Lentiviral Transduction Particles
glucoside xylosyltransferase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198612.2-791s1c1
Sequence:CCGGGAAGCTTCTGAGGCAGTTTAACTCGAGTTAAACTGCCTCAGAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-1480s1c1
Sequence:CCGGGCTGCCTGGATATTTGTGTGTCTCGAGACACACAAATATCCAGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-1367s1c1
Sequence:CCGGCAAGCAAATTGAGAAGACGATCTCGAGATCGTCTTCTCAATTTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-563s1c1
Sequence:CCGGGCCCGAATTTGATAAACAGTTCTCGAGAACTGTTTATCAAATTCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198612.1-944s1c1
Sequence:CCGGCATAAGAAATACCCAGTTCAACTCGAGTTGAACTGGGTATTTCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198612.1-1128s1c1
Sequence:CCGGCCTGACCATTGCATGTATGGACTCGAGTCCATACATGCAATGGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198612.1-1085s1c1
Sequence:CCGGCCCAGAGTGTCTCTATGTGTTCTCGAGAACACATAGAGACACTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198612.1-927s1c1
Sequence:CCGGCTCATGAACTTGACTCGCATACTCGAGTATGCGAGTCAAGTTCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)