EMAIL THIS PAGE TO A FRIEND

GYG1

glycogenin 1

54 Gene Product Result for
Synonyms: GSD15 GYG
UniProtKB ID: P46976, D3DNH0, D3DNH1, D3DNH2, Q6FHZ1, Q9UNV0
Gene ID:
Human(2992) Summary: This gene encodes a member of the glycogenin family. Glycogenin is a glycosyltransferase that catalyzes the formation of a short glucose polymer from uridine diphosphate glucose in an autoglucosylation reaction. This reaction is followed by elongation and branching of the polymer, catalyzed by glycogen synthase and branching enzyme, to form glycogen. This gene is expressed in muscle and other tissues. Mutations in this gene result in glycogen storage disease XV. This gene has pseudogenes on chromosomes 1, 8 and 13 respectively. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
Rat(81675) glycogenin 1
chicken(425050) glycogenin 1
cow(280812) glycogenin 1
dog(611614) glycogenin 1
sheep(101103289) glycogenin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004130 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088341 MISSION® esiRNA esiRNA human GYG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004130 Rosetta Predictions human pricing
NM_031043 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167856 predicted 483
2 SASI_Hs01_00167857 predicted 873
3 SASI_Hs01_00167858 predicted 616
4 SASI_Hs01_00167859 predicted 1190
5 SASI_Hs01_00167860 predicted 458
6 SASI_Hs01_00167861 predicted 925
7 SASI_Hs01_00167862 predicted 793
8 SASI_Hs01_00167864 predicted 872
9 SASI_Hs01_00167865 predicted 574
10 SASI_Hs02_00336982 predicted 757
11 SASI_Hs01_00167863 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088370 predicted 1035
2 SASI_Rn02_00264265 predicted 294
3 SASI_Rn01_00088371 predicted 800
4 SASI_Rn01_00088372 predicted 216
5 SASI_Rn01_00088373 predicted 209
6 SASI_Rn01_00088374 predicted 1062
7 SASI_Rn01_00088375 predicted 554
8 SASI_Rn01_00088377 predicted 414
9 SASI_Rn01_00088378 predicted 1055
10 SASI_Rn02_00264266 predicted 1041
11 SASI_Rn01_00088369 predicted 438
12 SASI_Rn01_00088376 predicted 691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004130
VALIDATED
GYG1 MISSION shRNA Bacterial Glycerol Stock
glycogenin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004130.2-1594s1c1
Sequence:CCGGGCTGAGTGATTCATAAACATACTCGAGTATGTTTATGAATCACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004130.2-993s1c1
Sequence:CCGGCCGTTTGTATCCTCGGAAGAACTCGAGTTCTTCCGAGGATACAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004130.2-1041s1c1
Sequence:CCGGGCTGATTATATGGGAGCAGATCTCGAGATCTGCTCCCATATAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004130.2-319s1c1
Sequence:CCGGGCTGGTCGCTTACACAGTATTCTCGAGAATACTGTGTAAGCGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004130.2-542s1c1
Sequence:CCGGCCAAGGCATACTGAACACATTCTCGAGAATGTGTTCAGTATGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004130
VALIDATED
GYG1 MISSION shRNA shRNA Plasmid DNA
glycogenin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004130.2-1594s1c1
Sequence:CCGGGCTGAGTGATTCATAAACATACTCGAGTATGTTTATGAATCACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004130.2-993s1c1
Sequence:CCGGCCGTTTGTATCCTCGGAAGAACTCGAGTTCTTCCGAGGATACAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004130.2-1041s1c1
Sequence:CCGGGCTGATTATATGGGAGCAGATCTCGAGATCTGCTCCCATATAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004130.2-319s1c1
Sequence:CCGGGCTGGTCGCTTACACAGTATTCTCGAGAATACTGTGTAAGCGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004130.2-542s1c1
Sequence:CCGGCCAAGGCATACTGAACACATTCTCGAGAATGTGTTCAGTATGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004130
VALIDATED
GYG1 MISSION shRNA Lentiviral Transduction Particles
glycogenin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004130.2-1594s1c1
Sequence:CCGGGCTGAGTGATTCATAAACATACTCGAGTATGTTTATGAATCACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004130.2-993s1c1
Sequence:CCGGCCGTTTGTATCCTCGGAAGAACTCGAGTTCTTCCGAGGATACAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004130.2-1041s1c1
Sequence:CCGGGCTGATTATATGGGAGCAGATCTCGAGATCTGCTCCCATATAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004130.2-319s1c1
Sequence:CCGGGCTGGTCGCTTACACAGTATTCTCGAGAATACTGTGTAAGCGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004130.2-542s1c1
Sequence:CCGGCCAAGGCATACTGAACACATTCTCGAGAATGTGTTCAGTATGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)