EMAIL THIS PAGE TO A FRIEND

GYG2

glycogenin 2

35 Gene Product Result for
Synonyms: GN-2 GN2
Gene ID:
Human(8908) Summary: This gene encodes a member of the the glycogenin family. Glycogenin is a self-glucosylating protein involved in the initiation reactions of glycogen biosynthesis. A gene on chromosome 3 encodes the muscle glycogenin and this X-linked gene encodes the glycogenin mainly present in liver; both are involved in blood glucose homeostasis. This gene has a short version on chromosome Y, which is 3' truncated and can not make a functional protein. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, May 2010]
Zebrafish(561803) glycogenin 2
chicken(418660) glycogenin 2
cow(505258) glycogenin 2
dog(491717) glycogenin 2
sheep(101115765) glycogenin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003918 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071671 MISSION® esiRNA esiRNA human GYG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079855 Rosetta Predictions human pricing
NM_003918 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313910 predicted 889
2 SASI_Hs02_00313911 predicted 1791
3 SASI_Hs02_00313912 predicted 558
4 SASI_Hs02_00313913 predicted 534
5 SASI_Hs02_00313914 predicted 1350
6 SASI_Hs02_00313915 predicted 1391
7 SASI_Hs02_00313916 predicted 781
8 SASI_Hs02_00313917 predicted 861
9 SASI_Hs02_00313918 predicted 1449
10 SASI_Hs02_00313919 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168598 predicted 982
2 SASI_Hs01_00168599 predicted 1879
3 SASI_Hs01_00168602 predicted 651
4 SASI_Hs01_00168603 predicted 628
5 SASI_Hs02_00336561 predicted 1442
6 SASI_Hs02_00336562 predicted 1485
7 SASI_Hs01_00168605 predicted 879
8 SASI_Hs01_00168606 predicted 954
9 SASI_Hs01_00168607 predicted 1548
10 SASI_Hs02_00336563 predicted 1324
11 SASI_Hs01_00168600 predicted 1214
12 SASI_Hs01_00168601 predicted 1508
13 SASI_Hs01_00168604 predicted 1514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003918
VALIDATED
GYG2 MISSION shRNA Bacterial Glycerol Stock
glycogenin 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-1520s1c1
Sequence:CCGGCAGCCAGCAAATAAAGTCGAACTCGAGTTCGACTTTATTTGCTGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003918.1-3042s1c1
Sequence:CCGGCCTGCCTGAATTTATGGCATTCTCGAGAATGCCATAAATTCAGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003918.1-1805s1c1
Sequence:CCGGGCGTTGTGTGTAGTTAGACAACTCGAGTTGTCTAACTACACACAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003918.1-2049s1c1
Sequence:CCGGGCGAGCAGTAATAACATTCTACTCGAGTAGAATGTTATTACTGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003918.1-871s1c1
Sequence:CCGGCCAAGGCTTACTGAATAGTTTCTCGAGAAACTATTCAGTAAGCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003918.1-538s1c1
Sequence:CCGGGAAGGTGTTCGATGAAGTCATCTCGAGATGACTTCATCGAACACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-1311s1c1
Sequence:CCGGCAAATTCACCACTGGGTTCTACTCGAGTAGAACCCAGTGGTGAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003918.1-928s1c1
Sequence:CCGGCCTGCCGTTCATCTATAACTTCTCGAGAAGTTATAGATGAACGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-978s1c1
Sequence:CCGGCTGCCTTCAAGCAATTCGGTTCTCGAGAACCGAATTGCTTGAAGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003918.1-803s1c1
Sequence:CCGGCCTTCTCTCCACACGCATAAACTCGAGTTTATGCGTGTGGAGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-1490s1c1
Sequence:CCGGGCAGACTTCACAGAGACTGAACTCGAGTTCAGTCTCTGTGAAGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003918.2-802s21c1
Sequence:CCGGCCTTCTCTCCACACGCATAAACTCGAGTTTATGCGTGTGGAGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003918.2-2048s21c1
Sequence:CCGGGCGAGCAGTAATAACATTCTACTCGAGTAGAATGTTATTACTGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003918.2-1310s21c1
Sequence:CCGGCAAATTCACCACTGGGTTCTACTCGAGTAGAACCCAGTGGTGAATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003918.2-1804s21c1
Sequence:CCGGGCGTTGTGTGTAGTTAGACAACTCGAGTTGTCTAACTACACACAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003918.2-537s21c1
Sequence:CCGGGAAGGTGTTCGATGAAGTCATCTCGAGATGACTTCATCGAACACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003918
VALIDATED
GYG2 MISSION shRNA shRNA Plasmid DNA
glycogenin 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-1520s1c1
Sequence:CCGGCAGCCAGCAAATAAAGTCGAACTCGAGTTCGACTTTATTTGCTGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003918.1-3042s1c1
Sequence:CCGGCCTGCCTGAATTTATGGCATTCTCGAGAATGCCATAAATTCAGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003918.1-1805s1c1
Sequence:CCGGGCGTTGTGTGTAGTTAGACAACTCGAGTTGTCTAACTACACACAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003918.1-2049s1c1
Sequence:CCGGGCGAGCAGTAATAACATTCTACTCGAGTAGAATGTTATTACTGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003918.1-871s1c1
Sequence:CCGGCCAAGGCTTACTGAATAGTTTCTCGAGAAACTATTCAGTAAGCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003918.1-538s1c1
Sequence:CCGGGAAGGTGTTCGATGAAGTCATCTCGAGATGACTTCATCGAACACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-1311s1c1
Sequence:CCGGCAAATTCACCACTGGGTTCTACTCGAGTAGAACCCAGTGGTGAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003918.1-928s1c1
Sequence:CCGGCCTGCCGTTCATCTATAACTTCTCGAGAAGTTATAGATGAACGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-978s1c1
Sequence:CCGGCTGCCTTCAAGCAATTCGGTTCTCGAGAACCGAATTGCTTGAAGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003918.1-803s1c1
Sequence:CCGGCCTTCTCTCCACACGCATAAACTCGAGTTTATGCGTGTGGAGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-1490s1c1
Sequence:CCGGGCAGACTTCACAGAGACTGAACTCGAGTTCAGTCTCTGTGAAGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003918.2-802s21c1
Sequence:CCGGCCTTCTCTCCACACGCATAAACTCGAGTTTATGCGTGTGGAGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003918.2-2048s21c1
Sequence:CCGGGCGAGCAGTAATAACATTCTACTCGAGTAGAATGTTATTACTGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003918.2-1310s21c1
Sequence:CCGGCAAATTCACCACTGGGTTCTACTCGAGTAGAACCCAGTGGTGAATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003918.2-1804s21c1
Sequence:CCGGGCGTTGTGTGTAGTTAGACAACTCGAGTTGTCTAACTACACACAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003918.2-537s21c1
Sequence:CCGGGAAGGTGTTCGATGAAGTCATCTCGAGATGACTTCATCGAACACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003918
VALIDATED
GYG2 MISSION shRNA Lentiviral Transduction Particles
glycogenin 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-1520s1c1
Sequence:CCGGCAGCCAGCAAATAAAGTCGAACTCGAGTTCGACTTTATTTGCTGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003918.1-3042s1c1
Sequence:CCGGCCTGCCTGAATTTATGGCATTCTCGAGAATGCCATAAATTCAGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003918.1-1805s1c1
Sequence:CCGGGCGTTGTGTGTAGTTAGACAACTCGAGTTGTCTAACTACACACAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003918.1-2049s1c1
Sequence:CCGGGCGAGCAGTAATAACATTCTACTCGAGTAGAATGTTATTACTGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003918.1-871s1c1
Sequence:CCGGCCAAGGCTTACTGAATAGTTTCTCGAGAAACTATTCAGTAAGCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003918.1-538s1c1
Sequence:CCGGGAAGGTGTTCGATGAAGTCATCTCGAGATGACTTCATCGAACACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-1311s1c1
Sequence:CCGGCAAATTCACCACTGGGTTCTACTCGAGTAGAACCCAGTGGTGAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003918.1-928s1c1
Sequence:CCGGCCTGCCGTTCATCTATAACTTCTCGAGAAGTTATAGATGAACGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-978s1c1
Sequence:CCGGCTGCCTTCAAGCAATTCGGTTCTCGAGAACCGAATTGCTTGAAGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003918.1-803s1c1
Sequence:CCGGCCTTCTCTCCACACGCATAAACTCGAGTTTATGCGTGTGGAGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003918.1-1490s1c1
Sequence:CCGGGCAGACTTCACAGAGACTGAACTCGAGTTCAGTCTCTGTGAAGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003918.2-802s21c1
Sequence:CCGGCCTTCTCTCCACACGCATAAACTCGAGTTTATGCGTGTGGAGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003918.2-2048s21c1
Sequence:CCGGGCGAGCAGTAATAACATTCTACTCGAGTAGAATGTTATTACTGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003918.2-1310s21c1
Sequence:CCGGCAAATTCACCACTGGGTTCTACTCGAGTAGAACCCAGTGGTGAATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003918.2-1804s21c1
Sequence:CCGGGCGTTGTGTGTAGTTAGACAACTCGAGTTGTCTAACTACACACAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003918.2-537s21c1
Sequence:CCGGGAAGGTGTTCGATGAAGTCATCTCGAGATGACTTCATCGAACACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)