EMAIL THIS PAGE TO A FRIEND

GYLTL1B

glycosyltransferase-like 1B

45 Gene Product Result for
Synonyms: LARGE2
UniProtKB ID: Q8N3Y3, A6NN75, Q8N8Y6, Q8NAK3, Q8WY62
Gene ID:
Mouse(228366) glycosyltransferase-like 1B
Rat(311202) glycosyltransferase-like 1B
domestic guinea pig(100724633) glycosyltransferase-like 1B
naked mole-rat(101699577) glycosyltransferase-like 1B
sheep(101117447) glycosyltransferase-like 1B
Domestic Rabbit(100349053) glycosyltransferase-like 1B
Zebrafish(446214) glycosyltransferase-like 1b
chicken(423200) glycosyltransferase-like 1B
dog(483638) glycosyltransferase-like 1B
Horse(100056834) glycosyltransferase-like 1B
cow(510504) glycosyltransferase-like 1B
domestic cat(101085315) glycosyltransferase-like 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA056621 Anti-LARGE2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152312 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152312 Rosetta Predictions human pricing
NM_199107 Rosetta Predictions rat pricing
NM_172670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169733 predicted 2296
2 SASI_Hs01_00169735 predicted 1681
3 SASI_Hs01_00169736 predicted 1840
4 SASI_Hs01_00169737 predicted 525
5 SASI_Hs01_00169738 predicted 1937
6 SASI_Hs02_00365897 predicted 1668
7 SASI_Hs01_00169739 predicted 1643
8 SASI_Hs01_00169742 predicted 480
9 SASI_Hs02_00365898 predicted 504
10 SASI_Hs02_00365899 predicted 1826
11 SASI_Hs01_00169734 predicted 1684
12 SASI_Hs01_00169740 predicted 1756
13 SASI_Hs01_00169741 predicted 1774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059855 predicted 1401
2 SASI_Rn01_00059856 predicted 331
3 SASI_Rn01_00059857 predicted 1496
4 SASI_Rn01_00059858 predicted 1719
5 SASI_Rn01_00059859 predicted 1028
6 SASI_Rn01_00059860 predicted 844
7 SASI_Rn01_00059861 predicted 342
8 SASI_Rn01_00059862 predicted 1909
9 SASI_Rn01_00059863 predicted 308
10 SASI_Rn01_00059864 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076771 predicted 1470
2 SASI_Mm02_00344383 predicted 1305
3 SASI_Mm01_00076772 predicted 711
4 SASI_Mm01_00076773 predicted 299
5 SASI_Mm01_00076774 predicted 377
6 SASI_Mm01_00076776 predicted 1576
7 SASI_Mm01_00076777 predicted 1412
8 SASI_Mm01_00076778 predicted 1919
9 SASI_Mm01_00076779 predicted 1859
10 SASI_Mm01_00076780 predicted 964
11 SASI_Mm01_00076775 predicted 1849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152312
GYLTL1B MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase-like 1B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152312.3-1992s21c1
Sequence:CCGGCCGCTATGATCCTCGCTTTGTCTCGAGACAAAGCGAGGATCATAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152312.3-1658s21c1
Sequence:CCGGACGTCTTCCTCAGTGACATTGCTCGAGCAATGTCACTGAGGAAGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-1164s1c1
Sequence:CCGGGCATGTGGAATTCTTCCGCAACTCGAGTTGCGGAAGAATTCCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-2023s1c1
Sequence:CCGGTGGAACAAAGTGGCCCACATTCTCGAGAATGTGGGCCACTTTGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-639s1c1
Sequence:CCGGCGGCCTCTATGGGCTAATGAACTCGAGTTCATTAGCCCATAGAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-1122s1c1
Sequence:CCGGGATCCACTGGAACTCACCAAACTCGAGTTTGGTGAGTTCCAGTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-1689s1c1
Sequence:CCGGTGCCTATTCTCTCTACGACTACTCGAGTAGTCGTAGAGAGAATAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152312
GYLTL1B MISSION shRNA shRNA Plasmid DNA
glycosyltransferase-like 1B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152312.3-1992s21c1
Sequence:CCGGCCGCTATGATCCTCGCTTTGTCTCGAGACAAAGCGAGGATCATAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152312.3-1658s21c1
Sequence:CCGGACGTCTTCCTCAGTGACATTGCTCGAGCAATGTCACTGAGGAAGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-1164s1c1
Sequence:CCGGGCATGTGGAATTCTTCCGCAACTCGAGTTGCGGAAGAATTCCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-2023s1c1
Sequence:CCGGTGGAACAAAGTGGCCCACATTCTCGAGAATGTGGGCCACTTTGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-639s1c1
Sequence:CCGGCGGCCTCTATGGGCTAATGAACTCGAGTTCATTAGCCCATAGAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-1122s1c1
Sequence:CCGGGATCCACTGGAACTCACCAAACTCGAGTTTGGTGAGTTCCAGTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-1689s1c1
Sequence:CCGGTGCCTATTCTCTCTACGACTACTCGAGTAGTCGTAGAGAGAATAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152312
GYLTL1B MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase-like 1B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152312.3-1992s21c1
Sequence:CCGGCCGCTATGATCCTCGCTTTGTCTCGAGACAAAGCGAGGATCATAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152312.3-1658s21c1
Sequence:CCGGACGTCTTCCTCAGTGACATTGCTCGAGCAATGTCACTGAGGAAGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-1164s1c1
Sequence:CCGGGCATGTGGAATTCTTCCGCAACTCGAGTTGCGGAAGAATTCCACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-2023s1c1
Sequence:CCGGTGGAACAAAGTGGCCCACATTCTCGAGAATGTGGGCCACTTTGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-639s1c1
Sequence:CCGGCGGCCTCTATGGGCTAATGAACTCGAGTTCATTAGCCCATAGAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-1122s1c1
Sequence:CCGGGATCCACTGGAACTCACCAAACTCGAGTTTGGTGAGTTCCAGTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152312.2-1689s1c1
Sequence:CCGGTGCCTATTCTCTCTACGACTACTCGAGTAGTCGTAGAGAGAATAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172670
GYLTL1B MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase-like 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172670.1-2139s1c1
Sequence:CCGGCCCTTACTGCTATTTAAGTTACTCGAGTAACTTAAATAGCAGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-1470s1c1
Sequence:CCGGCCTCAGTGATATTGACTTCTTCTCGAGAAGAAGTCAATATCACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-969s1c1
Sequence:CCGGGCACGCAGAATTCTTCCGTAACTCGAGTTACGGAAGAATTCTGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-379s1c1
Sequence:CCGGGTCAGCTTCTATGATGCGGAACTCGAGTTCCGCATCATAGAAGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-1602s1c1
Sequence:CCGGGTTCAGCTTCCCAAACTCTAACTCGAGTTAGAGTTTGGGAAGCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172670
GYLTL1B MISSION shRNA shRNA Plasmid DNA
glycosyltransferase-like 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172670.1-2139s1c1
Sequence:CCGGCCCTTACTGCTATTTAAGTTACTCGAGTAACTTAAATAGCAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-1470s1c1
Sequence:CCGGCCTCAGTGATATTGACTTCTTCTCGAGAAGAAGTCAATATCACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-969s1c1
Sequence:CCGGGCACGCAGAATTCTTCCGTAACTCGAGTTACGGAAGAATTCTGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-379s1c1
Sequence:CCGGGTCAGCTTCTATGATGCGGAACTCGAGTTCCGCATCATAGAAGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-1602s1c1
Sequence:CCGGGTTCAGCTTCCCAAACTCTAACTCGAGTTAGAGTTTGGGAAGCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172670
GYLTL1B MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase-like 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172670.1-2139s1c1
Sequence:CCGGCCCTTACTGCTATTTAAGTTACTCGAGTAACTTAAATAGCAGTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-1470s1c1
Sequence:CCGGCCTCAGTGATATTGACTTCTTCTCGAGAAGAAGTCAATATCACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-969s1c1
Sequence:CCGGGCACGCAGAATTCTTCCGTAACTCGAGTTACGGAAGAATTCTGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-379s1c1
Sequence:CCGGGTCAGCTTCTATGATGCGGAACTCGAGTTCCGCATCATAGAAGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172670.1-1602s1c1
Sequence:CCGGGTTCAGCTTCCCAAACTCTAACTCGAGTTAGAGTTTGGGAAGCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)