EMAIL THIS PAGE TO A FRIEND

GYPA

glycophorin A (MNS blood group)

155 Gene Product Result for
Synonyms: CD235a GPA GPErik GPSAT HGpMiV HGpMiXI HGpSta(C) MN MNS PAS-2
UniProtKB ID: P02724, A8K3E6, Q9BS51
Gene ID:
Human(2993) Summary: Glycophorins A (GYPA) and B (GYPB) are major sialoglycoproteins of the human erythrocyte membrane which bear the antigenic determinants for the MN and Ss blood groups. In addition to the M or N and S or s antigens that commonly occur in all populations, about 40 related variant phenotypes have been identified. These variants include all the variants of the Miltenberger complex and several isoforms of Sta, as well as Dantu, Sat, He, Mg, and deletion variants Ena, S-s-U- and Mk. Most of the variants are the result of gene recombinations between GYPA and GYPB. [provided by RefSeq, Jul 2008]
Mouse(14934) glycophorin A
dog(100126181) glycophorin A (MNS blood group)
cow(617836) glycophorin A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002099 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002099 Rosetta Predictions human pricing
NM_010369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113287 predicted 752
2 SASI_Hs01_00113291 predicted 863
3 SASI_Hs01_00113293 predicted 853
4 SASI_Hs02_00333205 predicted 383
5 SASI_Hs01_00113295 predicted 367
6 SASI_Hs02_00333206 predicted 293
7 SASI_Hs02_00333207 predicted 256
8 SASI_Hs02_00333208 predicted 449
9 SASI_Hs02_00333209 predicted 553
10 SASI_Hs02_00333210 predicted 746
11 SASI_Hs01_00113288 predicted 809
12 SASI_Hs01_00113289 predicted 382
13 SASI_Hs01_00113290 predicted 499
14 SASI_Hs01_00113292 predicted 388
15 SASI_Hs01_00113294 predicted 322
16 SASI_Hs01_00113296 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318429 predicted 781
2 SASI_Mm02_00318430 predicted 395
3 SASI_Mm01_00129427 predicted 200
4 SASI_Mm01_00129430 predicted 320
5 SASI_Mm02_00318431 predicted 726
6 SASI_Mm02_00318432 predicted 789
7 SASI_Mm02_00318433 predicted 761
8 SASI_Mm01_00129434 predicted 381
9 SASI_Mm02_00318434 predicted 464
10 SASI_Mm02_00318435 predicted 656
11 SASI_Mm01_00129428 predicted 572
12 SASI_Mm01_00129429 predicted 555
13 SASI_Mm01_00129431 predicted 803
14 SASI_Mm01_00129432 predicted 528
15 SASI_Mm01_00129433 predicted 764
16 SASI_Mm01_00129435 predicted 935
17 SASI_Mm01_00129436 predicted 594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010369
GYPA MISSION shRNA Bacterial Glycerol Stock
glycophorin A (MNS blood group)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010369.2-1280s1c1
Sequence:CCGGCCGTCCTTTAAGGCTGATGTACTCGAGTACATCAGCCTTAAAGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-567s1c1
Sequence:CCGGCCATATACCTTCAAGTCAACACTCGAGTGTTGACTTGAAGGTATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-560s1c1
Sequence:CCGGCCACCTTCCATATACCTTCAACTCGAGTTGAAGGTATATGGAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-738s1c1
Sequence:CCGGGCCGTCACCAATTGCAACAATCTCGAGATTGTTGCAATTGGTGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-799s1c1
Sequence:CCGGCCTACTGAAGTGCAACACGATCTCGAGATCGTGTTGCACTTCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010369
GYPA MISSION shRNA shRNA Plasmid DNA
glycophorin A (MNS blood group)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010369.2-1280s1c1
Sequence:CCGGCCGTCCTTTAAGGCTGATGTACTCGAGTACATCAGCCTTAAAGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-567s1c1
Sequence:CCGGCCATATACCTTCAAGTCAACACTCGAGTGTTGACTTGAAGGTATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-560s1c1
Sequence:CCGGCCACCTTCCATATACCTTCAACTCGAGTTGAAGGTATATGGAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-738s1c1
Sequence:CCGGGCCGTCACCAATTGCAACAATCTCGAGATTGTTGCAATTGGTGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-799s1c1
Sequence:CCGGCCTACTGAAGTGCAACACGATCTCGAGATCGTGTTGCACTTCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010369
GYPA MISSION shRNA Lentiviral Transduction Particles
glycophorin A (MNS blood group)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091613    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010369.2-1280s1c1
Sequence:CCGGCCGTCCTTTAAGGCTGATGTACTCGAGTACATCAGCCTTAAAGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-567s1c1
Sequence:CCGGCCATATACCTTCAAGTCAACACTCGAGTGTTGACTTGAAGGTATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-560s1c1
Sequence:CCGGCCACCTTCCATATACCTTCAACTCGAGTTGAAGGTATATGGAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-738s1c1
Sequence:CCGGGCCGTCACCAATTGCAACAATCTCGAGATTGTTGCAATTGGTGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010369.2-799s1c1
Sequence:CCGGCCTACTGAAGTGCAACACGATCTCGAGATCGTGTTGCACTTCAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002099
GYPA MISSION shRNA Bacterial Glycerol Stock
glycophorin A (MNS blood group)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002099.2-972s1c1
Sequence:CCGGCCTATCATTCATTCCTTCATTCTCGAGAATGAAGGAATGAATGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-460s1c1
Sequence:CCGGGCCTTTAAGTTCTGTTGAAATCTCGAGATTTCAACAGAACTTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-182s1c1
Sequence:CCGGCAGACAAATGATACGCACAAACTCGAGTTTGTGCGTATCATTTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-362s1c1
Sequence:CCGGGTTATTGGAACGATCCTCTTACTCGAGTAAGAGGATCGTTCCAATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-320s1c1
Sequence:CCGGGAACCAGAGATAACACTCATTCTCGAGAATGAGTGTTATCTCTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002099.4-1022s21c1
Sequence:CCGGGACACTAAAGTCCTATCATTCCTCGAGGAATGATAGGACTTTAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002099.4-345s21c1
Sequence:CCGGACCGGAGAAAGGGTACAACTTCTCGAGAAGTTGTACCCTTTCTCCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002099.4-947s21c1
Sequence:CCGGACCTAGATGAAGTTTAGATTTCTCGAGAAATCTAAACTTCATCTAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002099
GYPA MISSION shRNA shRNA Plasmid DNA
glycophorin A (MNS blood group)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002099.2-972s1c1
Sequence:CCGGCCTATCATTCATTCCTTCATTCTCGAGAATGAAGGAATGAATGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-460s1c1
Sequence:CCGGGCCTTTAAGTTCTGTTGAAATCTCGAGATTTCAACAGAACTTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-182s1c1
Sequence:CCGGCAGACAAATGATACGCACAAACTCGAGTTTGTGCGTATCATTTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-362s1c1
Sequence:CCGGGTTATTGGAACGATCCTCTTACTCGAGTAAGAGGATCGTTCCAATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-320s1c1
Sequence:CCGGGAACCAGAGATAACACTCATTCTCGAGAATGAGTGTTATCTCTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002099.4-1022s21c1
Sequence:CCGGGACACTAAAGTCCTATCATTCCTCGAGGAATGATAGGACTTTAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002099.4-345s21c1
Sequence:CCGGACCGGAGAAAGGGTACAACTTCTCGAGAAGTTGTACCCTTTCTCCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002099.4-947s21c1
Sequence:CCGGACCTAGATGAAGTTTAGATTTCTCGAGAAATCTAAACTTCATCTAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002099
GYPA MISSION shRNA Lentiviral Transduction Particles
glycophorin A (MNS blood group)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002099.2-972s1c1
Sequence:CCGGCCTATCATTCATTCCTTCATTCTCGAGAATGAAGGAATGAATGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-460s1c1
Sequence:CCGGGCCTTTAAGTTCTGTTGAAATCTCGAGATTTCAACAGAACTTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-182s1c1
Sequence:CCGGCAGACAAATGATACGCACAAACTCGAGTTTGTGCGTATCATTTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-362s1c1
Sequence:CCGGGTTATTGGAACGATCCTCTTACTCGAGTAAGAGGATCGTTCCAATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002099.2-320s1c1
Sequence:CCGGGAACCAGAGATAACACTCATTCTCGAGAATGAGTGTTATCTCTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002099.4-1022s21c1
Sequence:CCGGGACACTAAAGTCCTATCATTCCTCGAGGAATGATAGGACTTTAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002099.4-345s21c1
Sequence:CCGGACCGGAGAAAGGGTACAACTTCTCGAGAAGTTGTACCCTTTCTCCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002099.4-947s21c1
Sequence:CCGGACCTAGATGAAGTTTAGATTTCTCGAGAAATCTAAACTTCATCTAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)