EMAIL THIS PAGE TO A FRIEND

GYPB

glycophorin B (MNS blood group)

16 Gene Product Result for
Synonyms: CD235b GPB GPB.NY GYPHe.NY GpMiIII HGpMiIII HGpMiVI HGpMiX MNS PAS-3 SS
Gene ID:
Human(2994) Summary: Glycophorins A (GYPA) and B (GYPB) are major sialoglycoproteins of the human erythrocyte membrane which bear the antigenic determinants for the MN and Ss blood groups. GYPB gene consists of 5 exons and has 97% sequence homology with GYPA from the 5' UTR to the coding sequence encoding the first 45 amino acids. In addition to the M or N and S or s antigens, that commonly occur in all populations, about 40 related variant phenotypes have been identified. These variants include all the variants of the Miltenberger complex and several isoforms of Sta; also, Dantu, Sat, He, Mg, and deletion variants Ena, S-s-U- and Mk. Most of the variants are the result of gene recombinations between GYPA and GYPB. [provided by RefSeq, Jul 2008]
cow(100462649) glycophorin B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304962 ANTI-GYPB (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
G7650 Monoclonal Anti-Glycophorin A,B (α,δ) antibody produced in mouse clone E3, purified from hybridoma cell culture human
agglutination assay, flow cytometry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002100 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125561 MISSION® esiRNA esiRNA human GYPB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002100 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159223 predicted 232
2 SASI_Hs01_00159224 predicted 112
3 SASI_Hs01_00159225 predicted 279
4 SASI_Hs01_00159226 predicted 227
5 SASI_Hs02_00333211 predicted 73
6 SASI_Hs01_00159227 predicted 282
7 SASI_Hs01_00159228 predicted 255
8 SASI_Hs01_00159229 predicted 265
9 SASI_Hs01_00159230 predicted 116
10 SASI_Hs01_00159231 predicted 86
11 SASI_Hs01_00159232 predicted 137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002100
GYPB MISSION shRNA Bacterial Glycerol Stock
glycophorin B (MNS blood group)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002100.3-273s21c1
Sequence:CCGGGGTATTATTGGAACGATCCTCCTCGAGGAGGATCGTTCCAATAATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002100.3-187s21c1
Sequence:CCGCCAAATGGAGAAACGGGACAACCTCGAGGTTGTCCCGTTTCTCCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002100.2-367s1c1
Sequence:CCGGTGCTGCCTGATCTTGCGATAACTCGAGTTATCGCAAGATCAGGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-199s1c1
Sequence:CCGGCGGGACAACTTGTCCATCGTTCTCGAGAACGATGGACAAGTTGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-260s1c1
Sequence:CCGGGTGTGTGATGGCTGGTATTATCTCGAGATAATACCAGCCATCACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-178s1c1
Sequence:CCGGCATCACAGACAAATGGAGAAACTCGAGTTTCTCCATTTGTCTGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-228s1c1
Sequence:CCGGCCAGCTCCTGTAGTGATAATACTCGAGTATTATCACTACAGGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002100
GYPB MISSION shRNA shRNA Plasmid DNA
glycophorin B (MNS blood group)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002100.3-273s21c1
Sequence:CCGGGGTATTATTGGAACGATCCTCCTCGAGGAGGATCGTTCCAATAATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002100.3-187s21c1
Sequence:CCGCCAAATGGAGAAACGGGACAACCTCGAGGTTGTCCCGTTTCTCCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002100.2-367s1c1
Sequence:CCGGTGCTGCCTGATCTTGCGATAACTCGAGTTATCGCAAGATCAGGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-199s1c1
Sequence:CCGGCGGGACAACTTGTCCATCGTTCTCGAGAACGATGGACAAGTTGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-260s1c1
Sequence:CCGGGTGTGTGATGGCTGGTATTATCTCGAGATAATACCAGCCATCACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-178s1c1
Sequence:CCGGCATCACAGACAAATGGAGAAACTCGAGTTTCTCCATTTGTCTGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-228s1c1
Sequence:CCGGCCAGCTCCTGTAGTGATAATACTCGAGTATTATCACTACAGGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002100
GYPB MISSION shRNA Lentiviral Transduction Particles
glycophorin B (MNS blood group)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002100.3-273s21c1
Sequence:CCGGGGTATTATTGGAACGATCCTCCTCGAGGAGGATCGTTCCAATAATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002100.3-187s21c1
Sequence:CCGCCAAATGGAGAAACGGGACAACCTCGAGGTTGTCCCGTTTCTCCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002100.2-367s1c1
Sequence:CCGGTGCTGCCTGATCTTGCGATAACTCGAGTTATCGCAAGATCAGGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-199s1c1
Sequence:CCGGCGGGACAACTTGTCCATCGTTCTCGAGAACGATGGACAAGTTGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-260s1c1
Sequence:CCGGGTGTGTGATGGCTGGTATTATCTCGAGATAATACCAGCCATCACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-178s1c1
Sequence:CCGGCATCACAGACAAATGGAGAAACTCGAGTTTCTCCATTTGTCTGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002100.2-228s1c1
Sequence:CCGGCCAGCTCCTGTAGTGATAATACTCGAGTATTATCACTACAGGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)