EMAIL THIS PAGE TO A FRIEND

GYPC

glycophorin C (Gerbich blood group)

74 Gene Product Result for
Synonyms: CD236 CD236R GE GPC GPD GYPD PAS-2 PAS-2'
UniProtKB ID: P04921, B2R522, Q53SV9, Q92642
Gene ID:
Human(2995) Summary: Glycophorin C (GYPC) is an integral membrane glycoprotein. It is a minor species carried by human erythrocytes, but plays an important role in regulating the mechanical stability of red cells. A number of glycophorin C mutations have been described. The Gerbich and Yus phenotypes are due to deletion of exon 3 and 2, respectively. The Webb and Duch antigens, also known as glycophorin D, result from single point mutations of the glycophorin C gene. The glycophorin C protein has very little homology with glycophorins A and B. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Mouse(71683) glycophorin C
Rat(364837) glycophorin C (Gerbich blood group)
Zebrafish(335987) glycophorin C (Gerbich blood group)
cow(444863) glycophorin C (Gerbich blood group)
dog(609898) glycophorin C (Gerbich blood group)
domestic cat(101097411) glycophorin C (Gerbich blood group)
chicken(424230) glycophorin C (Gerbich blood group)
sheep(100885767) glycophorin C (Gerbich blood group)
domestic guinea pig(100722309) glycophorin C (Gerbich blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002101 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001048207 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001048207 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001048207 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002101 Rosetta Predictions human pricing
NM_016815 Rosetta Predictions human pricing
NM_001013233 Rosetta Predictions rat pricing
NM_001048207 Rosetta Predictions mouse pricing
NM_027863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204808 predicted 504
2 SASI_Hs01_00204810 predicted 646
3 SASI_Hs01_00204811 predicted 489
4 SASI_Hs01_00204813 predicted 658
5 SASI_Hs01_00204814 predicted 530
6 SASI_Hs01_00204815 predicted 662
7 SASI_Hs01_00204816 predicted 541
8 SASI_Hs01_00204817 predicted 493
9 SASI_Hs02_00333212 predicted 547
10 SASI_Hs02_00333213 predicted 524
11 SASI_Hs01_00204809 predicted 633
12 SASI_Hs01_00204812 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180055 predicted 451
2 SASI_Hs01_00180057 predicted 590
3 SASI_Hs01_00180058 predicted 439
4 SASI_Hs01_00180060 predicted 601
5 SASI_Hs01_00180061 predicted 469
6 SASI_Hs01_00180062 predicted 600
7 SASI_Hs01_00180063 predicted 482
8 SASI_Hs01_00180064 predicted 439
9 SASI_Hs02_00349869 predicted 487
10 SASI_Hs02_00349870 predicted 462
11 SASI_Hs01_00180056 predicted 574
12 SASI_Hs01_00180059 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053227 predicted 731
2 SASI_Rn01_00053228 predicted 989
3 SASI_Rn01_00053229 predicted 683
4 SASI_Rn01_00053230 predicted 971
5 SASI_Rn01_00053231 predicted 423
6 SASI_Rn01_00053232 predicted 475
7 SASI_Rn01_00053233 predicted 658
8 SASI_Rn01_00053234 predicted 813
9 SASI_Rn01_00053235 predicted 771
10 SASI_Rn01_00053236 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048207 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292209 predicted 871
2 SASI_Mm02_00292210 predicted 464
3 SASI_Mm02_00292211 predicted 950
4 SASI_Mm02_00292212 predicted 947
5 SASI_Mm02_00292213 predicted 961
6 SASI_Mm02_00292214 predicted 727
7 SASI_Mm02_00292215 predicted 699
8 SASI_Mm02_00292216 predicted 474
9 SASI_Mm02_00292217 predicted 945
10 SASI_Mm02_00292218 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136532 predicted 813
2 SASI_Mm01_00136533 predicted 898
3 SASI_Mm01_00136534 predicted 888
4 SASI_Mm01_00136535 predicted 908
5 SASI_Mm01_00136536 predicted 671
6 SASI_Mm01_00136537 predicted 649
7 SASI_Mm01_00136538 predicted 957
8 SASI_Mm01_00136539 predicted 889
9 SASI_Mm01_00136540 predicted 1190
10 SASI_Mm01_00136541 predicted 778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002101
GYPC MISSION shRNA Bacterial Glycerol Stock
glycophorin C (Gerbich blood group)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002101.3-648s1c1
Sequence:CCGGGCACTTGATTCTTCCCGAGATCTCGAGATCTCGGGAAGAATCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-507s1c1
Sequence:CCGGTGCTGGTGATAGCAGCAGAAACTCGAGTTTCTGCTGCTATCACCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-518s1c1
Sequence:CCGGGCAGCAGAAAGGAGTACTTTACTCGAGTAAAGTACTCCTTTCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-230s1c1
Sequence:CCGGCCTCCACCACAATGCATACTACTCGAGTAGTATGCATTGTGGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-334s1c1
Sequence:CCGGGTCGTCATTGCAGGTGTGATTCTCGAGAATCACACCTGCAATGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002101.3-622s21c1
Sequence:CCGGCTGATACCACCAGACAGAGAGCTCGAGCTCTCTGTCTGGTGGTATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002101.3-253s21c1
Sequence:CCGGACCATTGCAGAGCCTGATCCACTCGAGTGGATCAGGCTCTGCAATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002101.3-386s21c1
Sequence:CCGGTCTTCGTCATGCTGCGCTACACTCGAGTGTAGCGCAGCATGACGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002101.3-551s21c1
Sequence:CCGGCAGACTTCACTTCCCTGAATGCTCGAGCATTCAGGGAAGTGAAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002101
GYPC MISSION shRNA shRNA Plasmid DNA
glycophorin C (Gerbich blood group)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002101.3-648s1c1
Sequence:CCGGGCACTTGATTCTTCCCGAGATCTCGAGATCTCGGGAAGAATCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-507s1c1
Sequence:CCGGTGCTGGTGATAGCAGCAGAAACTCGAGTTTCTGCTGCTATCACCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-518s1c1
Sequence:CCGGGCAGCAGAAAGGAGTACTTTACTCGAGTAAAGTACTCCTTTCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-230s1c1
Sequence:CCGGCCTCCACCACAATGCATACTACTCGAGTAGTATGCATTGTGGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-334s1c1
Sequence:CCGGGTCGTCATTGCAGGTGTGATTCTCGAGAATCACACCTGCAATGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002101.3-622s21c1
Sequence:CCGGCTGATACCACCAGACAGAGAGCTCGAGCTCTCTGTCTGGTGGTATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002101.3-253s21c1
Sequence:CCGGACCATTGCAGAGCCTGATCCACTCGAGTGGATCAGGCTCTGCAATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002101.3-386s21c1
Sequence:CCGGTCTTCGTCATGCTGCGCTACACTCGAGTGTAGCGCAGCATGACGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002101.3-551s21c1
Sequence:CCGGCAGACTTCACTTCCCTGAATGCTCGAGCATTCAGGGAAGTGAAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002101
GYPC MISSION shRNA Lentiviral Transduction Particles
glycophorin C (Gerbich blood group)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002101.3-648s1c1
Sequence:CCGGGCACTTGATTCTTCCCGAGATCTCGAGATCTCGGGAAGAATCAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-507s1c1
Sequence:CCGGTGCTGGTGATAGCAGCAGAAACTCGAGTTTCTGCTGCTATCACCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-518s1c1
Sequence:CCGGGCAGCAGAAAGGAGTACTTTACTCGAGTAAAGTACTCCTTTCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-230s1c1
Sequence:CCGGCCTCCACCACAATGCATACTACTCGAGTAGTATGCATTGTGGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002101.3-334s1c1
Sequence:CCGGGTCGTCATTGCAGGTGTGATTCTCGAGAATCACACCTGCAATGACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002101.3-622s21c1
Sequence:CCGGCTGATACCACCAGACAGAGAGCTCGAGCTCTCTGTCTGGTGGTATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002101.3-253s21c1
Sequence:CCGGACCATTGCAGAGCCTGATCCACTCGAGTGGATCAGGCTCTGCAATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002101.3-386s21c1
Sequence:CCGGTCTTCGTCATGCTGCGCTACACTCGAGTGTAGCGCAGCATGACGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002101.3-551s21c1
Sequence:CCGGCAGACTTCACTTCCCTGAATGCTCGAGCATTCAGGGAAGTGAAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027863
VALIDATED
GYPC MISSION shRNA Bacterial Glycerol Stock
glycophorin C (Gerbich blood group)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-542s1c1
Sequence:CCGGCCCAAGACTCTTACTGCAGAACTCGAGTTCTGCAGTAAGAGTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-667s1c1
Sequence:CCGGGAGAGAACATCTGGATACCCACTCGAGTGGGTATCCAGATGTTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-1898s1c1
Sequence:CCGGGCCATAGTTGACACCCATTAACTCGAGTTAATGGGTGTCAACTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-705s1c1
Sequence:CCGGCAGGTATCATCTCACCAGCATCTCGAGATGCTGGTGAGATGATACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027863
VALIDATED
GYPC MISSION shRNA shRNA Plasmid DNA
glycophorin C (Gerbich blood group)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-542s1c1
Sequence:CCGGCCCAAGACTCTTACTGCAGAACTCGAGTTCTGCAGTAAGAGTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-667s1c1
Sequence:CCGGGAGAGAACATCTGGATACCCACTCGAGTGGGTATCCAGATGTTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-1898s1c1
Sequence:CCGGGCCATAGTTGACACCCATTAACTCGAGTTAATGGGTGTCAACTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-705s1c1
Sequence:CCGGCAGGTATCATCTCACCAGCATCTCGAGATGCTGGTGAGATGATACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027863
VALIDATED
GYPC MISSION shRNA Lentiviral Transduction Particles
glycophorin C (Gerbich blood group)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-542s1c1
Sequence:CCGGCCCAAGACTCTTACTGCAGAACTCGAGTTCTGCAGTAAGAGTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-667s1c1
Sequence:CCGGGAGAGAACATCTGGATACCCACTCGAGTGGGTATCCAGATGTTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-1898s1c1
Sequence:CCGGGCCATAGTTGACACCCATTAACTCGAGTTAATGGGTGTCAACTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027863.2-705s1c1
Sequence:CCGGCAGGTATCATCTCACCAGCATCTCGAGATGCTGGTGAGATGATACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048207
VALIDATED
GYPC MISSION shRNA Bacterial Glycerol Stock
glycophorin C (Gerbich blood group)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-260s21c1
Sequence:CCGGAGGGAAGTCCTACGGCATTATCTCGAGATAATGCCGTAGGACTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-472s21c1
Sequence:CCGGCCAGCAAGAAGGAATACTTTACTCGAGTAAAGTATTCCTTCTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-344s21c1
Sequence:CCGGTCTCATGCTTCGCTACCTGTACTCGAGTACAGGTAGCGAAGCATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048207.1-292s21c1
Sequence:CCGGTCATTGCAGCTGTGATCACTGCTCGAGCAGTGATCACAGCTGCAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-602s21c1
Sequence:CCGGCCCAAGACTCTTACTGCAGAACTCGAGTTCTGCAGTAAGAGTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048207
VALIDATED
GYPC MISSION shRNA shRNA Plasmid DNA
glycophorin C (Gerbich blood group)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-260s21c1
Sequence:CCGGAGGGAAGTCCTACGGCATTATCTCGAGATAATGCCGTAGGACTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-472s21c1
Sequence:CCGGCCAGCAAGAAGGAATACTTTACTCGAGTAAAGTATTCCTTCTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-344s21c1
Sequence:CCGGTCTCATGCTTCGCTACCTGTACTCGAGTACAGGTAGCGAAGCATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048207.1-292s21c1
Sequence:CCGGTCATTGCAGCTGTGATCACTGCTCGAGCAGTGATCACAGCTGCAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-602s21c1
Sequence:CCGGCCCAAGACTCTTACTGCAGAACTCGAGTTCTGCAGTAAGAGTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048207
VALIDATED
GYPC MISSION shRNA Lentiviral Transduction Particles
glycophorin C (Gerbich blood group)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-260s21c1
Sequence:CCGGAGGGAAGTCCTACGGCATTATCTCGAGATAATGCCGTAGGACTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-472s21c1
Sequence:CCGGCCAGCAAGAAGGAATACTTTACTCGAGTAAAGTATTCCTTCTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-344s21c1
Sequence:CCGGTCTCATGCTTCGCTACCTGTACTCGAGTACAGGTAGCGAAGCATGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048207.1-292s21c1
Sequence:CCGGTCATTGCAGCTGTGATCACTGCTCGAGCAGTGATCACAGCTGCAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001048207.1-602s21c1
Sequence:CCGGCCCAAGACTCTTACTGCAGAACTCGAGTTCTGCAGTAAGAGTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)