EMAIL THIS PAGE TO A FRIEND

GYPE

glycophorin E (MNS blood group)

58 Gene Product Result for
Synonyms: GPE MNS MiIX
Species: Human GYPE(2996)
UniProtKB ID: P15421, D3DNZ5
Gene ID:
Human(2996) Summary: The protein encoded by this gene is a sialoglycoprotein and a type I membrane protein. It is a member of a gene family with GPA and GPB genes. This encoded protein might carry the M blood group antigen. GYPA, GYPB, and GYPE are organized in tandem on chromosome 4. This gene might have derived from an ancestral gene common to the GPB gene by gene duplication. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002102 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035921 MISSION® esiRNA esiRNA human GYPE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002102 Rosetta Predictions human pricing
NM_198682 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039045 predicted 196
2 SASI_Hs01_00039046 predicted 252
3 SASI_Hs01_00039047 predicted 116
4 SASI_Hs01_00039048 predicted 230
5 SASI_Hs01_00039049 predicted 184
6 SASI_Hs01_00039050 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114282 predicted 499
2 SASI_Hs01_00114283 predicted 192
3 SASI_Hs01_00114285 predicted 262
4 SASI_Hs01_00114286 predicted 250
5 SASI_Hs01_00114287 predicted 747
6 SASI_Hs01_00114288 predicted 622
7 SASI_Hs01_00114289 predicted 446
8 SASI_Hs01_00114290 predicted 422
9 SASI_Hs01_00114291 predicted 481
10 SASI_Hs02_00372253 predicted 279
11 SASI_Hs01_00114284 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002102
GYPE MISSION shRNA Bacterial Glycerol Stock
glycophorin E (MNS blood group)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-214s21c1
Sequence:CCGGGGGCGATGGCTCGTGTTATTTCTCGAGAAATAACACGAGCCATCGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-179s21c1
Sequence:CCGGATCACAGACAAATGGGATAACCTCGAGGTTATCCCATTTGTCTGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-242s1c1
Sequence:CCGGGATGCTTGTTGTTGTTGGAATCTCGAGATTCCAACAACAACAAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-280s21c1
Sequence:CCGGACTGTATTCGATGACTGATAACTCGAGTTATCAGTCATCGAATACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002102.2-324s1c1
Sequence:CCGGGCTGCCTGATCTTGCCTAGAACTCGAGTTCTAGGCAAGATCAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-187s1c1
Sequence:CCGGCAAATGGGATAACACTCATTACTCGAGTAATGAGTGTTATCCCATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-200s1c1
Sequence:CCGGACTCATTAATTGGTGGGCGATCTCGAGATCGCCCACCAATTAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-111s21c1
Sequence:CCGGGCATCAAGTACCACTGGTGTGCTCGAGCACACCAGTGGTACTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-252s1c1
Sequence:CCGGGTTGTTGGAATGATCATCTTACTCGAGTAAGATGATCATTCCAACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002102
GYPE MISSION shRNA shRNA Plasmid DNA
glycophorin E (MNS blood group)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-214s21c1
Sequence:CCGGGGGCGATGGCTCGTGTTATTTCTCGAGAAATAACACGAGCCATCGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-179s21c1
Sequence:CCGGATCACAGACAAATGGGATAACCTCGAGGTTATCCCATTTGTCTGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-242s1c1
Sequence:CCGGGATGCTTGTTGTTGTTGGAATCTCGAGATTCCAACAACAACAAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-280s21c1
Sequence:CCGGACTGTATTCGATGACTGATAACTCGAGTTATCAGTCATCGAATACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002102.2-324s1c1
Sequence:CCGGGCTGCCTGATCTTGCCTAGAACTCGAGTTCTAGGCAAGATCAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-187s1c1
Sequence:CCGGCAAATGGGATAACACTCATTACTCGAGTAATGAGTGTTATCCCATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-200s1c1
Sequence:CCGGACTCATTAATTGGTGGGCGATCTCGAGATCGCCCACCAATTAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-111s21c1
Sequence:CCGGGCATCAAGTACCACTGGTGTGCTCGAGCACACCAGTGGTACTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-252s1c1
Sequence:CCGGGTTGTTGGAATGATCATCTTACTCGAGTAAGATGATCATTCCAACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002102
GYPE MISSION shRNA Lentiviral Transduction Particles
glycophorin E (MNS blood group)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-214s21c1
Sequence:CCGGGGGCGATGGCTCGTGTTATTTCTCGAGAAATAACACGAGCCATCGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-179s21c1
Sequence:CCGGATCACAGACAAATGGGATAACCTCGAGGTTATCCCATTTGTCTGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-242s1c1
Sequence:CCGGGATGCTTGTTGTTGTTGGAATCTCGAGATTCCAACAACAACAAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-280s21c1
Sequence:CCGGACTGTATTCGATGACTGATAACTCGAGTTATCAGTCATCGAATACAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116667    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002102.2-324s1c1
Sequence:CCGGGCTGCCTGATCTTGCCTAGAACTCGAGTTCTAGGCAAGATCAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-187s1c1
Sequence:CCGGCAAATGGGATAACACTCATTACTCGAGTAATGAGTGTTATCCCATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-200s1c1
Sequence:CCGGACTCATTAATTGGTGGGCGATCTCGAGATCGCCCACCAATTAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002102.3-111s21c1
Sequence:CCGGGCATCAAGTACCACTGGTGTGCTCGAGCACACCAGTGGTACTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002102.2-252s1c1
Sequence:CCGGGTTGTTGGAATGATCATCTTACTCGAGTAAGATGATCATTCCAACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)