EMAIL THIS PAGE TO A FRIEND

GYS1

glycogen synthase 1 (muscle)

93 Gene Product Result for
Synonyms: GSY GYS
UniProtKB ID: P13807, Q9BTT9
Gene ID:
Human(2997) Summary: The protein encoded by this gene catalyzes the addition of glucose monomers to the growing glycogen molecule through the formation of alpha-1,4-glycoside linkages. Mutations in this gene are associated with muscle glycogen storage disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(14936) glycogen synthase 1, muscle
Rat(690987) glycogen synthase 1, muscle
Zebrafish(394155) glycogen synthase 1 (muscle)
domestic cat(101100682) glycogen synthase 1 (muscle)
cow(511047) glycogen synthase 1 (muscle)
cow(786335) glycogen synthase 1 (muscle)
Horse(100054723) glycogen synthase 1 (muscle)
chicken(378934) glycogen synthase 1 (muscle)
dog(611993) glycogen synthase 1 (muscle)
domestic guinea pig(100730435) glycogen synthase 1 (muscle)
naked mole-rat(101712358) glycogen synthase 1 (muscle)
sheep(101108772) glycogen synthase 1 (muscle)
Domestic Rabbit(100008660) glycogen synthase 1 (muscle)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200218 Anti-Glycogen Synthase 1 (N-terminal) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody mouse, rat
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB4200217 Anti-Glycogen Synthase 1 antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody rat, human, mouse
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB4300648 Anti-Glycogen Synthase antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4501356 Anti-Glycogen Synthase, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB2900333 Anti-GYS1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
HPA041598 Anti-GYS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503873 Anti-phospho-Glycogen Synthase (pSer645) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301443 Anti-phospho-Glycogen Synthase (pSer645) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB5300091 Monoclonal Anti-GYS1 antibody produced in mouse clone 3A7, ascites fluid human
ELISA, flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002103 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002103 Rosetta Predictions human pricing
NM_001109615 Rosetta Predictions rat pricing
NM_030678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177141 predicted 1385
2 SASI_Hs01_00177142 predicted 1138
3 SASI_Hs01_00177143 predicted 285
4 SASI_Hs01_00177144 predicted 1285
5 SASI_Hs01_00177145 predicted 1170
6 SASI_Hs01_00177147 predicted 2234
7 SASI_Hs01_00177148 predicted 1968
8 SASI_Hs01_00177149 predicted 693
9 SASI_Hs02_00333214 predicted 1432
10 SASI_Hs02_00333215 predicted 431
11 SASI_Hs01_00177140 predicted 1812
12 SASI_Hs01_00177146 predicted 1429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250112 predicted 1327
2 SASI_Rn02_00250113 predicted 652
3 SASI_Rn02_00250114 predicted 1269
4 SASI_Rn02_00250115 predicted 1216
5 SASI_Rn02_00250116 predicted 724
6 SASI_Rn02_00250117 predicted 1272
7 SASI_Rn02_00250118 predicted 1290
8 SASI_Rn02_00250119 predicted 1550
9 SASI_Rn02_00250120 predicted 1893
10 SASI_Rn02_00250121 predicted 1998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170586 predicted 1647
2 SASI_Mm01_00170587 predicted 1090
3 SASI_Mm01_00170588 predicted 1127
4 SASI_Mm01_00170589 predicted 1482
5 SASI_Mm01_00170590 predicted 1157
6 SASI_Mm01_00170591 predicted 2263
7 SASI_Mm01_00170592 predicted 1268
8 SASI_Mm01_00170594 predicted 730
9 SASI_Mm01_00170595 predicted 1275
10 SASI_Mm02_00336823 predicted 1888
11 SASI_Mm01_00170593 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030678
VALIDATED
GYS1 MISSION shRNA Bacterial Glycerol Stock
glycogen synthase 1 (muscle)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-2575s1c1
Sequence:CCGGGCTTCTTCGTTTGATCCTATACTCGAGTATAGGATCAAACGAAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-761s1c1
Sequence:CCGGGCCCATGTCTTCACTACCGTACTCGAGTACGGTAGTGAAGACATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030678.2-1117s1c1
Sequence:CCGGCCGGACCAATAATTTCAACGTCTCGAGACGTTGAAATTATTGGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-292s1c1
Sequence:CCGGCAGCAAGGGTTGTAAGGTGTACTCGAGTACACCTTACAACCCTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-952s1c1
Sequence:CCGGCCTGGACTTCAACCTAGACAACTCGAGTTGTCTAGGTTGAAGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030678
VALIDATED
GYS1 MISSION shRNA shRNA Plasmid DNA
glycogen synthase 1 (muscle)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-2575s1c1
Sequence:CCGGGCTTCTTCGTTTGATCCTATACTCGAGTATAGGATCAAACGAAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-761s1c1
Sequence:CCGGGCCCATGTCTTCACTACCGTACTCGAGTACGGTAGTGAAGACATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030678.2-1117s1c1
Sequence:CCGGCCGGACCAATAATTTCAACGTCTCGAGACGTTGAAATTATTGGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-292s1c1
Sequence:CCGGCAGCAAGGGTTGTAAGGTGTACTCGAGTACACCTTACAACCCTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-952s1c1
Sequence:CCGGCCTGGACTTCAACCTAGACAACTCGAGTTGTCTAGGTTGAAGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030678
VALIDATED
GYS1 MISSION shRNA Lentiviral Transduction Particles
glycogen synthase 1 (muscle)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-2575s1c1
Sequence:CCGGGCTTCTTCGTTTGATCCTATACTCGAGTATAGGATCAAACGAAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-761s1c1
Sequence:CCGGGCCCATGTCTTCACTACCGTACTCGAGTACGGTAGTGAAGACATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030678.2-1117s1c1
Sequence:CCGGCCGGACCAATAATTTCAACGTCTCGAGACGTTGAAATTATTGGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-292s1c1
Sequence:CCGGCAGCAAGGGTTGTAAGGTGTACTCGAGTACACCTTACAACCCTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030678.2-952s1c1
Sequence:CCGGCCTGGACTTCAACCTAGACAACTCGAGTTGTCTAGGTTGAAGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002103
VALIDATED
GYS1 MISSION shRNA Bacterial Glycerol Stock
glycogen synthase 1 (muscle)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_002103.3-987s1c1
Sequence:CCGGGCTCAAGAGGAAACCAGATATCTCGAGATATCTGGTTTCCTCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002103.3-1920s1c1
Sequence:CCGGGCAGCGTATCATCCAGCGGAACTCGAGTTCCGCTGGATGATACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002103.3-468s1c1
Sequence:CCGGCAAGGGCTGCAAGGTGTATTTCTCGAGAAATACACCTTGCAGCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002103.3-1170s1c1
Sequence:CCGGCCGCTATGAGTTCTCCAACAACTCGAGTTGTTGGAGAACTCATAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002103.3-1819s1c1
Sequence:CCGGGCTTACGGTATCTACATTCTTCTCGAGAAGAATGTAGATACCGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-1977s21c1
Sequence:CCGGATACCTAGGCCGGTACTATATCTCGAGATATAGTACCGGCCTAGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-3404s21c1
Sequence:CCGGTGCCTTCAGCTTTGGTGAAAGCTCGAGCTTTCACCAAAGCTGAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-1214s21c1
Sequence:CCGGCATTGGCTCGGCTCAACTATCCTCGAGGATAGTTGAGCCGAGCCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-1134s21c1
Sequence:CCGGCAACTTGGACAAGACCTTATACTCGAGTATAAGGTCTTGTCCAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-468s21c1
Sequence:CCGGCAAGGGCTGCAAGGTGTATTTCTCGAGAAATACACCTTGCAGCCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002103
VALIDATED
GYS1 MISSION shRNA shRNA Plasmid DNA
glycogen synthase 1 (muscle)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_002103.3-987s1c1
Sequence:CCGGGCTCAAGAGGAAACCAGATATCTCGAGATATCTGGTTTCCTCTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002103.3-1920s1c1
Sequence:CCGGGCAGCGTATCATCCAGCGGAACTCGAGTTCCGCTGGATGATACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002103.3-468s1c1
Sequence:CCGGCAAGGGCTGCAAGGTGTATTTCTCGAGAAATACACCTTGCAGCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002103.3-1170s1c1
Sequence:CCGGCCGCTATGAGTTCTCCAACAACTCGAGTTGTTGGAGAACTCATAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002103.3-1819s1c1
Sequence:CCGGGCTTACGGTATCTACATTCTTCTCGAGAAGAATGTAGATACCGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-1977s21c1
Sequence:CCGGATACCTAGGCCGGTACTATATCTCGAGATATAGTACCGGCCTAGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-3404s21c1
Sequence:CCGGTGCCTTCAGCTTTGGTGAAAGCTCGAGCTTTCACCAAAGCTGAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-1214s21c1
Sequence:CCGGCATTGGCTCGGCTCAACTATCCTCGAGGATAGTTGAGCCGAGCCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-1134s21c1
Sequence:CCGGCAACTTGGACAAGACCTTATACTCGAGTATAAGGTCTTGTCCAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-468s21c1
Sequence:CCGGCAAGGGCTGCAAGGTGTATTTCTCGAGAAATACACCTTGCAGCCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002103
VALIDATED
GYS1 MISSION shRNA Lentiviral Transduction Particles
glycogen synthase 1 (muscle)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_002103.3-987s1c1
Sequence:CCGGGCTCAAGAGGAAACCAGATATCTCGAGATATCTGGTTTCCTCTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002103.3-1920s1c1
Sequence:CCGGGCAGCGTATCATCCAGCGGAACTCGAGTTCCGCTGGATGATACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002103.3-468s1c1
Sequence:CCGGCAAGGGCTGCAAGGTGTATTTCTCGAGAAATACACCTTGCAGCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002103.3-1170s1c1
Sequence:CCGGCCGCTATGAGTTCTCCAACAACTCGAGTTGTTGGAGAACTCATAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002103.3-1819s1c1
Sequence:CCGGGCTTACGGTATCTACATTCTTCTCGAGAAGAATGTAGATACCGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-1977s21c1
Sequence:CCGGATACCTAGGCCGGTACTATATCTCGAGATATAGTACCGGCCTAGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-3404s21c1
Sequence:CCGGTGCCTTCAGCTTTGGTGAAAGCTCGAGCTTTCACCAAAGCTGAAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-1214s21c1
Sequence:CCGGCATTGGCTCGGCTCAACTATCCTCGAGGATAGTTGAGCCGAGCCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-1134s21c1
Sequence:CCGGCAACTTGGACAAGACCTTATACTCGAGTATAAGGTCTTGTCCAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002103.3-468s21c1
Sequence:CCGGCAAGGGCTGCAAGGTGTATTTCTCGAGAAATACACCTTGCAGCCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)