EMAIL THIS PAGE TO A FRIEND

GYS2

glycogen synthase 2 (liver)

54 Gene Product Result for
UniProtKB ID: P54840, A0AVD8
Gene ID:
Human(2998) Summary: The protein encoded by this gene, liver glycogen synthase, catalyzes the rate-limiting step in the synthesis of glycogen - the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen molecule. Mutations in this gene cause glycogen storage disease type 0 (GSD-0) - a rare type of early childhood fasting hypoglycemia with decreased liver glycogen content. [provided by RefSeq, Dec 2009]
Mouse(232493) glycogen synthase 2
Rat(25623) glycogen synthase 2
sheep(101118685) glycogen synthase 2 (liver)
domestic guinea pig(100720245) glycogen synthase 2 (liver)
naked mole-rat(101699800) glycogen synthase 2 (liver)
Zebrafish(373082) glycogen synthase 2
cow(537451) glycogen synthase 2 (liver)
Horse(100064264) glycogen synthase 2 (liver)
chicken(418201) glycogen synthase 2 (liver)
dog(403737) glycogen synthase 2 (liver)
domestic cat(101092123) glycogen synthase 2 (liver)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021957 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005511 MISSION® esiRNA esiRNA targeting human GYS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021957 Rosetta Predictions human pricing
NM_013089 Rosetta Predictions rat pricing
NM_145572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355294 predicted 836
2 SASI_Hs01_00204282 predicted 700
3 SASI_Hs02_00355295 predicted 1519
4 SASI_Hs01_00204283 predicted 1282
5 SASI_Hs01_00204285 predicted 2274
6 SASI_Hs02_00355296 predicted 1326
7 SASI_Hs02_00355297 predicted 1749
8 SASI_Hs01_00204287 predicted 1711
9 SASI_Hs01_00204289 predicted 803
10 SASI_Hs01_00204290 predicted 716
11 SASI_Hs01_00204281 predicted 1879
12 SASI_Hs01_00204284 predicted 1536
13 SASI_Hs01_00204286 predicted 1108
14 SASI_Hs01_00204288 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056593 predicted 698
2 SASI_Rn01_00056595 predicted 1157
3 SASI_Rn01_00056596 predicted 1301
4 SASI_Rn01_00056597 predicted 485
5 SASI_Rn02_00260856 predicted 709
6 SASI_Rn01_00056598 predicted 1829
7 SASI_Rn01_00056599 predicted 1073
8 SASI_Rn01_00056600 predicted 933
9 SASI_Rn01_00056601 predicted 363
10 SASI_Rn01_00056602 predicted 1415
11 SASI_Rn01_00056594 predicted 2164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132104 predicted 1539
2 SASI_Mm01_00132105 predicted 526
3 SASI_Mm01_00132106 predicted 2100
4 SASI_Mm01_00132108 predicted 1567
5 SASI_Mm01_00132109 predicted 509
6 SASI_Mm01_00132110 predicted 2425
7 SASI_Mm01_00132111 predicted 1201
8 SASI_Mm02_00341086 predicted 1339
9 SASI_Mm02_00341087 predicted 824
10 SASI_Mm02_00341088 predicted 1680
11 SASI_Mm01_00132102 predicted 2052
12 SASI_Mm01_00132103 predicted 1280
13 SASI_Mm01_00132107 predicted 1163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021957
GYS2 MISSION shRNA Bacterial Glycerol Stock
glycogen synthase 2 (liver)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021957.3-917s21c1
Sequence:CCGGACAACCATCTTGATAAGTTTACTCGAGTAAACTTATCAAGATGGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021957.3-2532s21c1
Sequence:CCGCTAGGATAAGATCCAAGTTATTCTCGAGAATAACTTGGATCTTATCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021957.3-1516s21c1
Sequence:CCGGGATCGAGATGATCTAACAATTCTCGAGAATTGTTAGATCATCTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-1858s1c1
Sequence:CCGGCCTGACATTAAGCAGAGCTTTCTCGAGAAAGCTCTGCTTAATGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-349s1c1
Sequence:CCGGGCTGATAGAAGGAAGTCCTTACTCGAGTAAGGACTTCCTTCTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-1880s1c1
Sequence:CCGGCCAGATAAATTCCATGTGGAACTCGAGTTCCACATGGAATTTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-868s1c1
Sequence:CCGGCGGCTTGAATGTTAAGAAATTCTCGAGAATTTCTTAACATTCAAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021957
GYS2 MISSION shRNA shRNA Plasmid DNA
glycogen synthase 2 (liver)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021957.3-917s21c1
Sequence:CCGGACAACCATCTTGATAAGTTTACTCGAGTAAACTTATCAAGATGGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021957.3-2532s21c1
Sequence:CCGCTAGGATAAGATCCAAGTTATTCTCGAGAATAACTTGGATCTTATCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021957.3-1516s21c1
Sequence:CCGGGATCGAGATGATCTAACAATTCTCGAGAATTGTTAGATCATCTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-1858s1c1
Sequence:CCGGCCTGACATTAAGCAGAGCTTTCTCGAGAAAGCTCTGCTTAATGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-349s1c1
Sequence:CCGGGCTGATAGAAGGAAGTCCTTACTCGAGTAAGGACTTCCTTCTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-1880s1c1
Sequence:CCGGCCAGATAAATTCCATGTGGAACTCGAGTTCCACATGGAATTTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-868s1c1
Sequence:CCGGCGGCTTGAATGTTAAGAAATTCTCGAGAATTTCTTAACATTCAAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021957
GYS2 MISSION shRNA Lentiviral Transduction Particles
glycogen synthase 2 (liver)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021957.3-917s21c1
Sequence:CCGGACAACCATCTTGATAAGTTTACTCGAGTAAACTTATCAAGATGGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021957.3-2532s21c1
Sequence:CCGCTAGGATAAGATCCAAGTTATTCTCGAGAATAACTTGGATCTTATCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021957.3-1516s21c1
Sequence:CCGGGATCGAGATGATCTAACAATTCTCGAGAATTGTTAGATCATCTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-1858s1c1
Sequence:CCGGCCTGACATTAAGCAGAGCTTTCTCGAGAAAGCTCTGCTTAATGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-349s1c1
Sequence:CCGGGCTGATAGAAGGAAGTCCTTACTCGAGTAAGGACTTCCTTCTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-1880s1c1
Sequence:CCGGCCAGATAAATTCCATGTGGAACTCGAGTTCCACATGGAATTTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021957.2-868s1c1
Sequence:CCGGCGGCTTGAATGTTAAGAAATTCTCGAGAATTTCTTAACATTCAAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145572
GYS2 MISSION shRNA Bacterial Glycerol Stock
glycogen synthase 2 (liver)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145572.1-2344s1c1
Sequence:CCGGCCTGATGCAGACCAACAGATACTCGAGTATCTGTTGGTCTGCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-1387s1c1
Sequence:CCGGCGGGTTATTAAGAGGAGAAATCTCGAGATTTCTCCTCTTAATAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-677s1c1
Sequence:CCGGGCAGACGGTAAACACGTCATTCTCGAGAATGACGTGTTTACCGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-1801s1c1
Sequence:CCGGCCCTACTGCATACGGTATTTACTCGAGTAAATACCGTATGCAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-2206s1c1
Sequence:CCGGGCTAAATATCAAGTCACCGTTCTCGAGAACGGTGACTTGATATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145572
GYS2 MISSION shRNA shRNA Plasmid DNA
glycogen synthase 2 (liver)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145572.1-2344s1c1
Sequence:CCGGCCTGATGCAGACCAACAGATACTCGAGTATCTGTTGGTCTGCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-1387s1c1
Sequence:CCGGCGGGTTATTAAGAGGAGAAATCTCGAGATTTCTCCTCTTAATAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-677s1c1
Sequence:CCGGGCAGACGGTAAACACGTCATTCTCGAGAATGACGTGTTTACCGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-1801s1c1
Sequence:CCGGCCCTACTGCATACGGTATTTACTCGAGTAAATACCGTATGCAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-2206s1c1
Sequence:CCGGGCTAAATATCAAGTCACCGTTCTCGAGAACGGTGACTTGATATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145572
GYS2 MISSION shRNA Lentiviral Transduction Particles
glycogen synthase 2 (liver)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145572.1-2344s1c1
Sequence:CCGGCCTGATGCAGACCAACAGATACTCGAGTATCTGTTGGTCTGCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-1387s1c1
Sequence:CCGGCGGGTTATTAAGAGGAGAAATCTCGAGATTTCTCCTCTTAATAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-677s1c1
Sequence:CCGGGCAGACGGTAAACACGTCATTCTCGAGAATGACGTGTTTACCGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-1801s1c1
Sequence:CCGGCCCTACTGCATACGGTATTTACTCGAGTAAATACCGTATGCAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145572.1-2206s1c1
Sequence:CCGGGCTAAATATCAAGTCACCGTTCTCGAGAACGGTGACTTGATATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)