EMAIL THIS PAGE TO A FRIEND

GZF1

GDNF-inducible zinc finger protein 1

49 Gene Product Result for
Synonyms: ZBTB23 ZNF336
Gene ID:
Mouse(74533) GDNF-inducible zinc finger protein 1
Rat(311508) GDNF-inducible zinc finger protein 1
chicken(421232) GDNF-inducible zinc finger protein 1
domestic cat(101085877) GDNF-inducible zinc finger protein 1
cow(525199) GDNF-inducible zinc finger protein 1
Horse(100049901) GDNF-inducible zinc finger protein 1
dog(485737) GDNF-inducible zinc finger protein 1
domestic guinea pig(100720177) GDNF-inducible zinc finger protein 1
naked mole-rat(101702264) GDNF-inducible zinc finger protein 1
sheep(101103083) GDNF-inducible zinc finger protein 1
Domestic Rabbit(100351652) GDNF-inducible zinc finger protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA024520 Anti-GZF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV33281 Anti-ZNF336 antibody produced in rabbit affinity isolated antibody human, mouse, pig, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028986 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028986 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028986 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022482 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022482 Rosetta Predictions human pricing
NM_001107788 Rosetta Predictions rat pricing
NM_028986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355765 predicted 1774
2 SASI_Hs01_00060980 predicted 392
3 SASI_Hs01_00060981 predicted 1501
4 SASI_Hs01_00060982 predicted 349
5 SASI_Hs01_00060983 predicted 2108
6 SASI_Hs01_00060984 predicted 217
7 SASI_Hs01_00060985 predicted 1596
8 SASI_Hs01_00060986 predicted 1775
9 SASI_Hs01_00060988 predicted 1984
10 SASI_Hs01_00060989 predicted 455
11 SASI_Hs01_00060987 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232275 predicted 298
2 SASI_Rn02_00232276 predicted 1794
3 SASI_Rn02_00232277 predicted 2161
4 SASI_Rn02_00232278 predicted 1588
5 SASI_Rn02_00232279 predicted 816
6 SASI_Rn02_00232280 predicted 1400
7 SASI_Rn02_00232281 predicted 846
8 SASI_Rn02_00232282 predicted 491
9 SASI_Rn02_00232283 predicted 280
10 SASI_Rn02_00232284 predicted 1837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130064 predicted 291
2 SASI_Mm01_00130065 predicted 1639
3 SASI_Mm01_00130066 predicted 1605
4 SASI_Mm01_00130067 predicted 330
5 SASI_Mm01_00130068 predicted 314
6 SASI_Mm02_00334720 predicted 1927
7 SASI_Mm01_00130069 predicted 1787
8 SASI_Mm01_00130070 predicted 593
9 SASI_Mm01_00130071 predicted 1897
10 SASI_Mm01_00130072 predicted 1563
11 SASI_Mm01_00130073 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028986
GZF1 MISSION shRNA Bacterial Glycerol Stock
GDNF-inducible zinc finger protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028986.1-3010s1c1
Sequence:CCGGGCCTGGCAAATCTTGACTATTCTCGAGAATAGTCAAGATTTGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-598s1c1
Sequence:CCGGCCTTGTAGATTCCTCCGACTACTCGAGTAGTCGGAGGAATCTACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028986.3-1700s21c1
Sequence:CCGGCAATTCCCTGTACCAGCATATCTCGAGATATGCTGGTACAGGGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-1840s1c1
Sequence:CCGGGCATACCTCAATACATGATAACTCGAGTTATCATGTATTGAGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-1905s1c1
Sequence:CCGGCCAAGAATGATGAAGGGCATACTCGAGTATGCCCTTCATCATTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-320s1c1
Sequence:CCGGGCTGTTGACTTTGCTTCGTTTCTCGAGAAACGAAGCAAAGTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028986.3-2482s21c1
Sequence:CCGGGTACATGTCAATCACACTAATCTCGAGATTAGTGTGATTGACATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028986
GZF1 MISSION shRNA shRNA Plasmid DNA
GDNF-inducible zinc finger protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028986.1-3010s1c1
Sequence:CCGGGCCTGGCAAATCTTGACTATTCTCGAGAATAGTCAAGATTTGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-598s1c1
Sequence:CCGGCCTTGTAGATTCCTCCGACTACTCGAGTAGTCGGAGGAATCTACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028986.3-1700s21c1
Sequence:CCGGCAATTCCCTGTACCAGCATATCTCGAGATATGCTGGTACAGGGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-1840s1c1
Sequence:CCGGGCATACCTCAATACATGATAACTCGAGTTATCATGTATTGAGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-1905s1c1
Sequence:CCGGCCAAGAATGATGAAGGGCATACTCGAGTATGCCCTTCATCATTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-320s1c1
Sequence:CCGGGCTGTTGACTTTGCTTCGTTTCTCGAGAAACGAAGCAAAGTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028986.3-2482s21c1
Sequence:CCGGGTACATGTCAATCACACTAATCTCGAGATTAGTGTGATTGACATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028986
GZF1 MISSION shRNA Lentiviral Transduction Particles
GDNF-inducible zinc finger protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095179    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028986.1-3010s1c1
Sequence:CCGGGCCTGGCAAATCTTGACTATTCTCGAGAATAGTCAAGATTTGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-598s1c1
Sequence:CCGGCCTTGTAGATTCCTCCGACTACTCGAGTAGTCGGAGGAATCTACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028986.3-1700s21c1
Sequence:CCGGCAATTCCCTGTACCAGCATATCTCGAGATATGCTGGTACAGGGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-1840s1c1
Sequence:CCGGGCATACCTCAATACATGATAACTCGAGTTATCATGTATTGAGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-1905s1c1
Sequence:CCGGCCAAGAATGATGAAGGGCATACTCGAGTATGCCCTTCATCATTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028986.1-320s1c1
Sequence:CCGGGCTGTTGACTTTGCTTCGTTTCTCGAGAAACGAAGCAAAGTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028986.3-2482s21c1
Sequence:CCGGGTACATGTCAATCACACTAATCTCGAGATTAGTGTGATTGACATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022482
VALIDATED
GZF1 MISSION shRNA Bacterial Glycerol Stock
GDNF-inducible zinc finger protein 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1808s21c1
Sequence:CCGGGGAAGTCTTTCCTTGTCATTGCTCGAGCAATGACAAGGAAAGACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022482.3-1776s1c1
Sequence:CCGGGCACACCTCAATACACGATAACTCGAGTTATCGTGTATTGAGGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022482.3-253s1c1
Sequence:CCGGGCTGACTTTGCTTCATTTCTTCTCGAGAAGAAATGAAGCAAAGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022482.3-1425s1c1
Sequence:CCGGCCACATGCTGATTTATCATAACTCGAGTTATGATAAATCAGCATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1743s21c1
Sequence:CCGGACGGACATTCACCGACAAGTCCTCGAGGACTTGTCGGTGAATGTCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1499s21c1
Sequence:CCGGTTGCTTCTAAGGAGTACTTAACTCGAGTTAAGTACTCCTTAGAAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022482.3-1878s1c1
Sequence:CCGGCGAAGAGTATGTGTCATCCAACTCGAGTTGGATGACACATACTCTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-944s21c1
Sequence:CCGGGCAACTTTAAGTGCAGCATTTCTCGAGAAATGCTGCACTTAAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022482.3-2400s21c1
Sequence:CCGGGTATGTGCTAATCGTTCTAATCTCGAGATTAGAACGATTAGCACATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-618s21c1
Sequence:CCGGCAAGAAGAAAGAGGTAGTTAACTCGAGTTAACTACCTCTTTCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1531s21c1
Sequence:CCGGAGAATCCATACTGGATCCAAACTCGAGTTTGGATCCAGTATGGATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-392s21c1
Sequence:CCGGAGATGTTAGAGTCAGTACTTTCTCGAGAAAGTACTGACTCTAACATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-208s21c1
Sequence:CCGGGTGGATGGTACTAGGACTAATCTCGAGATTAGTCCTAGTACCATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022482.3-2272s21c1
Sequence:CCGGTGCTAACTTGCACGGCTTTATCTCGAGATAAAGCCGTGCAAGTTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1396s21c1
Sequence:CCGGGATGAATGTGGTGCAAGATTCCTCGAGGAATCTTGCACCACATTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022482
VALIDATED
GZF1 MISSION shRNA shRNA Plasmid DNA
GDNF-inducible zinc finger protein 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1808s21c1
Sequence:CCGGGGAAGTCTTTCCTTGTCATTGCTCGAGCAATGACAAGGAAAGACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022482.3-1776s1c1
Sequence:CCGGGCACACCTCAATACACGATAACTCGAGTTATCGTGTATTGAGGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022482.3-253s1c1
Sequence:CCGGGCTGACTTTGCTTCATTTCTTCTCGAGAAGAAATGAAGCAAAGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022482.3-1425s1c1
Sequence:CCGGCCACATGCTGATTTATCATAACTCGAGTTATGATAAATCAGCATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1743s21c1
Sequence:CCGGACGGACATTCACCGACAAGTCCTCGAGGACTTGTCGGTGAATGTCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1499s21c1
Sequence:CCGGTTGCTTCTAAGGAGTACTTAACTCGAGTTAAGTACTCCTTAGAAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022482.3-1878s1c1
Sequence:CCGGCGAAGAGTATGTGTCATCCAACTCGAGTTGGATGACACATACTCTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-944s21c1
Sequence:CCGGGCAACTTTAAGTGCAGCATTTCTCGAGAAATGCTGCACTTAAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022482.3-2400s21c1
Sequence:CCGGGTATGTGCTAATCGTTCTAATCTCGAGATTAGAACGATTAGCACATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-618s21c1
Sequence:CCGGCAAGAAGAAAGAGGTAGTTAACTCGAGTTAACTACCTCTTTCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1531s21c1
Sequence:CCGGAGAATCCATACTGGATCCAAACTCGAGTTTGGATCCAGTATGGATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-392s21c1
Sequence:CCGGAGATGTTAGAGTCAGTACTTTCTCGAGAAAGTACTGACTCTAACATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-208s21c1
Sequence:CCGGGTGGATGGTACTAGGACTAATCTCGAGATTAGTCCTAGTACCATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022482.3-2272s21c1
Sequence:CCGGTGCTAACTTGCACGGCTTTATCTCGAGATAAAGCCGTGCAAGTTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1396s21c1
Sequence:CCGGGATGAATGTGGTGCAAGATTCCTCGAGGAATCTTGCACCACATTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022482
VALIDATED
GZF1 MISSION shRNA Lentiviral Transduction Particles
GDNF-inducible zinc finger protein 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1808s21c1
Sequence:CCGGGGAAGTCTTTCCTTGTCATTGCTCGAGCAATGACAAGGAAAGACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_022482.3-1776s1c1
Sequence:CCGGGCACACCTCAATACACGATAACTCGAGTTATCGTGTATTGAGGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022482.3-253s1c1
Sequence:CCGGGCTGACTTTGCTTCATTTCTTCTCGAGAAGAAATGAAGCAAAGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022482.3-1425s1c1
Sequence:CCGGCCACATGCTGATTTATCATAACTCGAGTTATGATAAATCAGCATGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1743s21c1
Sequence:CCGGACGGACATTCACCGACAAGTCCTCGAGGACTTGTCGGTGAATGTCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1499s21c1
Sequence:CCGGTTGCTTCTAAGGAGTACTTAACTCGAGTTAAGTACTCCTTAGAAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022482.3-1878s1c1
Sequence:CCGGCGAAGAGTATGTGTCATCCAACTCGAGTTGGATGACACATACTCTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-944s21c1
Sequence:CCGGGCAACTTTAAGTGCAGCATTTCTCGAGAAATGCTGCACTTAAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022482.3-2400s21c1
Sequence:CCGGGTATGTGCTAATCGTTCTAATCTCGAGATTAGAACGATTAGCACATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-618s21c1
Sequence:CCGGCAAGAAGAAAGAGGTAGTTAACTCGAGTTAACTACCTCTTTCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1531s21c1
Sequence:CCGGAGAATCCATACTGGATCCAAACTCGAGTTTGGATCCAGTATGGATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-392s21c1
Sequence:CCGGAGATGTTAGAGTCAGTACTTTCTCGAGAAAGTACTGACTCTAACATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-208s21c1
Sequence:CCGGGTGGATGGTACTAGGACTAATCTCGAGATTAGTCCTAGTACCATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022482.3-2272s21c1
Sequence:CCGGTGCTAACTTGCACGGCTTTATCTCGAGATAAAGCCGTGCAAGTTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022482.3-1396s21c1
Sequence:CCGGGATGAATGTGGTGCAAGATTCCTCGAGGAATCTTGCACCACATTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)