EMAIL THIS PAGE TO A FRIEND

GZMA

granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)

55 Gene Product Result for
Synonyms: CTLA3 HFSP
UniProtKB ID: P12544, A4PHN1, Q6IB36
Gene ID:
Human(3001) Summary: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here is a T cell- and natural killer cell-specific serine protease that may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells. [provided by RefSeq, Jul 2008]
Mouse(14938) granzyme A
Rat(266708) granzyme A
Zebrafish(795070) granzyme A
cow(539093) granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
cow(407178) granzyme A
domestic cat(100113480) granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
dog(487207) granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
chicken(395108) granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006144 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040841 MISSION® esiRNA esiRNA human GZMA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006144 Rosetta Predictions human pricing
NM_153468 Rosetta Predictions rat pricing
NM_010370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116845 predicted 519
2 SASI_Hs01_00116846 predicted 418
3 SASI_Hs01_00116849 predicted 463
4 SASI_Hs01_00116850 predicted 308
5 SASI_Hs01_00116851 predicted 596
6 SASI_Hs01_00116852 predicted 568
7 SASI_Hs02_00340982 predicted 523
8 SASI_Hs01_00116853 predicted 499
9 SASI_Hs02_00340983 predicted 575
10 SASI_Hs02_00340984 predicted 651
11 SASI_Hs01_00116847 predicted 337
12 SASI_Hs01_00116848 predicted 511
13 SASI_Hs01_00116854 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055148 predicted 315
2 SASI_Rn01_00055149 predicted 298
3 SASI_Rn01_00055150 predicted 261
4 SASI_Rn01_00055151 predicted 386
5 SASI_Rn01_00055152 predicted 322
6 SASI_Rn01_00055153 predicted 555
7 SASI_Rn01_00055155 predicted 384
8 SASI_Rn01_00055156 predicted 339
9 SASI_Rn01_00055157 predicted 258
10 SASI_Rn02_00268979 predicted 268
11 SASI_Rn01_00055154 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186335 predicted 296
2 SASI_Mm01_00186336 predicted 239
3 SASI_Mm01_00186337 predicted 238
4 SASI_Mm01_00186338 predicted 292
5 SASI_Mm01_00186340 predicted 408
6 SASI_Mm01_00186341 predicted 410
7 SASI_Mm01_00186342 predicted 362
8 SASI_Mm01_00186343 predicted 401
9 SASI_Mm02_00318436 predicted 441
10 SASI_Mm01_00186344 predicted 332
11 SASI_Mm01_00186339 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006144
VALIDATED
GZMA MISSION shRNA Bacterial Glycerol Stock
granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006144.3-157s21c1
Sequence:CCGGACCCTACATGGTCCTACTTAGCTCGAGCTAAGTAGGACCATGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006144.3-645s21c1
Sequence:CCGGGTGGAAGAGACTCGTGCAATGCTCGAGCATTGCACGAGTCTCTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006144.3-321s21c1
Sequence:CCGGTGCTTGTTAAGAAAGAGTTTCCTCGAGGAAACTCTTTCTTAACAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006144.2-602s1c1
Sequence:CCGGCCCTGTGATTGGAATGAATATCTCGAGATATTCATTCCAATCACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_006144.2-527s1c1
Sequence:CCGGCGATACTCTGAGAGAAGTCAACTCGAGTTGACTTCTCTCAGAGTATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_006144.2-369s1c1
Sequence:CCGGCGCGAAGGTGACCTTAAACTTCTCGAGAAGTTTAAGGTCACCTTCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006144.2-240s1c1
Sequence:CCGGGCTCACTGTAACTTGAACAAACTCGAGTTTGTTCAAGTTACAGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_006144.2-67s1c1
Sequence:CCGGCCTCTCTCTCAGTTGTCGTTTCTCGAGAAACGACAACTGAGAGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006144
VALIDATED
GZMA MISSION shRNA shRNA Plasmid DNA
granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006144.3-157s21c1
Sequence:CCGGACCCTACATGGTCCTACTTAGCTCGAGCTAAGTAGGACCATGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006144.3-645s21c1
Sequence:CCGGGTGGAAGAGACTCGTGCAATGCTCGAGCATTGCACGAGTCTCTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006144.3-321s21c1
Sequence:CCGGTGCTTGTTAAGAAAGAGTTTCCTCGAGGAAACTCTTTCTTAACAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006144.2-602s1c1
Sequence:CCGGCCCTGTGATTGGAATGAATATCTCGAGATATTCATTCCAATCACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_006144.2-527s1c1
Sequence:CCGGCGATACTCTGAGAGAAGTCAACTCGAGTTGACTTCTCTCAGAGTATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_006144.2-369s1c1
Sequence:CCGGCGCGAAGGTGACCTTAAACTTCTCGAGAAGTTTAAGGTCACCTTCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006144.2-240s1c1
Sequence:CCGGGCTCACTGTAACTTGAACAAACTCGAGTTTGTTCAAGTTACAGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_006144.2-67s1c1
Sequence:CCGGCCTCTCTCTCAGTTGTCGTTTCTCGAGAAACGACAACTGAGAGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006144
VALIDATED
GZMA MISSION shRNA Lentiviral Transduction Particles
granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006144.3-157s21c1
Sequence:CCGGACCCTACATGGTCCTACTTAGCTCGAGCTAAGTAGGACCATGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006144.3-645s21c1
Sequence:CCGGGTGGAAGAGACTCGTGCAATGCTCGAGCATTGCACGAGTCTCTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006144.3-321s21c1
Sequence:CCGGTGCTTGTTAAGAAAGAGTTTCCTCGAGGAAACTCTTTCTTAACAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006144.2-602s1c1
Sequence:CCGGCCCTGTGATTGGAATGAATATCTCGAGATATTCATTCCAATCACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_006144.2-527s1c1
Sequence:CCGGCGATACTCTGAGAGAAGTCAACTCGAGTTGACTTCTCTCAGAGTATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_006144.2-369s1c1
Sequence:CCGGCGCGAAGGTGACCTTAAACTTCTCGAGAAGTTTAAGGTCACCTTCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006144.2-240s1c1
Sequence:CCGGGCTCACTGTAACTTGAACAAACTCGAGTTTGTTCAAGTTACAGTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_006144.2-67s1c1
Sequence:CCGGCCTCTCTCTCAGTTGTCGTTTCTCGAGAAACGACAACTGAGAGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010370
GZMA MISSION shRNA Bacterial Glycerol Stock
granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-420s1c1
Sequence:CCGGGCTATCCTTCACCTACCTAAACTCGAGTTTAGGTAGGTGAAGGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-327s1c1
Sequence:CCGGGCATTTCCCTATCCATGCTATCTCGAGATAGCATGGATAGGGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-151s1c1
Sequence:CCGGGACCGTATATGGCTCTACTTACTCGAGTAAGTAGAGCCATATACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-671s1c1
Sequence:CCGGCCCTCTGCTATGTGATGGTATCTCGAGATACCATCACATAGCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-513s1c1
Sequence:CCGGCCCTCTGAAACTCTGAGAGAACTCGAGTTCTCTCAGAGTTTCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010370
GZMA MISSION shRNA shRNA Plasmid DNA
granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-420s1c1
Sequence:CCGGGCTATCCTTCACCTACCTAAACTCGAGTTTAGGTAGGTGAAGGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-327s1c1
Sequence:CCGGGCATTTCCCTATCCATGCTATCTCGAGATAGCATGGATAGGGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-151s1c1
Sequence:CCGGGACCGTATATGGCTCTACTTACTCGAGTAAGTAGAGCCATATACGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-671s1c1
Sequence:CCGGCCCTCTGCTATGTGATGGTATCTCGAGATACCATCACATAGCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-513s1c1
Sequence:CCGGCCCTCTGAAACTCTGAGAGAACTCGAGTTCTCTCAGAGTTTCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010370
GZMA MISSION shRNA Lentiviral Transduction Particles
granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-420s1c1
Sequence:CCGGGCTATCCTTCACCTACCTAAACTCGAGTTTAGGTAGGTGAAGGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-327s1c1
Sequence:CCGGGCATTTCCCTATCCATGCTATCTCGAGATAGCATGGATAGGGAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-151s1c1
Sequence:CCGGGACCGTATATGGCTCTACTTACTCGAGTAAGTAGAGCCATATACGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-671s1c1
Sequence:CCGGCCCTCTGCTATGTGATGGTATCTCGAGATACCATCACATAGCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010370.1-513s1c1
Sequence:CCGGCCCTCTGAAACTCTGAGAGAACTCGAGTTCTCTCAGAGTTTCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)