EMAIL THIS PAGE TO A FRIEND

GZMB

granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)

82 Gene Product Result for
Synonyms: CCPI CGL-1 CGL1 CSP-B CSPB CTLA1 CTSGL1 HLP SECT
UniProtKB ID: P10144, Q8N1D2, Q9UCC1
Gene ID:
Human(3002) Summary: Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein encoded by this gene is crucial for the rapid induction of target cell apoptosis by CTL in cell-mediated immune response. [provided by RefSeq, Jul 2008]
Mouse(14939) granzyme B
Rat(171528) granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
dog(490630) granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
cow(508646) granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
cow(281731) granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
Horse(100033978) granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
domestic cat(100127106) granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
domestic guinea pig(100736180) granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
naked mole-rat(101702156) granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004131 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004131 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004131 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013542 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013542 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013542 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106641 MISSION® esiRNA esiRNA human GZMB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004131 Rosetta Predictions human pricing
NM_138517 Rosetta Predictions rat pricing
NM_013542 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041872 predicted 530
2 SASI_Hs01_00041873 predicted 585
3 SASI_Hs01_00041874 predicted 577
4 SASI_Hs01_00041875 predicted 205
5 SASI_Hs01_00041876 predicted 583
6 SASI_Hs01_00041877 predicted 554
7 SASI_Hs01_00041878 predicted 531
8 SASI_Hs01_00041879 predicted 555
9 SASI_Hs01_00041880 predicted 535
10 SASI_Hs01_00041881 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116989 predicted 569
2 SASI_Rn01_00116990 predicted 349
3 SASI_Rn01_00116991 predicted 623
4 SASI_Rn01_00116994 predicted 814
5 SASI_Rn01_00116997 predicted 580
6 SASI_Rn01_00116992 predicted 484
7 SASI_Rn01_00116995 predicted 469
8 SASI_Rn01_00116993 predicted 253
9 SASI_Rn01_00116996 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144314 predicted 419
2 SASI_Mm02_00322248 predicted 810
3 SASI_Mm02_00322249 predicted 867
4 SASI_Mm01_00144318 predicted 433
5 SASI_Mm01_00144319 predicted 754
6 SASI_Mm02_00322250 predicted 753
7 SASI_Mm01_00144320 predicted 305
8 SASI_Mm01_00144321 predicted 567
9 SASI_Mm02_00322251 predicted 506
10 SASI_Mm02_00322252 predicted 800
11 SASI_Mm01_00144315 predicted 1083
12 SASI_Mm01_00144316 predicted 688
13 SASI_Mm01_00144317 predicted 1144
14 SASI_Mm01_00144322 predicted 1137
15 SASI_Mm01_00144323 predicted 1100
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004131
GZMB MISSION shRNA Bacterial Glycerol Stock
granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-711s1c1
Sequence:CCGGCATTGTCTCCTATGGACGAAACTCGAGTTTCGTCCATAGGAGACAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-601s1c1
Sequence:CCGGCATTATTACGACAGTACCATTCTCGAGAATGGTACTGTCGTAATAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-172s1c1
Sequence:CCGGGCTTATCTTATGATCTGGGATCTCGAGATCCCAGATCATAAGATAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-218s1c1
Sequence:CCGGGCTTCCTGATACAAGACGACTCTCGAGAGTCGTCTTGTATCAGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-585s1c1
Sequence:CCGGCGAATCTGACTTACGCCATTACTCGAGTAATGGCGTAAGTCAGATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004131.4-540s21c1
Sequence:CCGGCACACTACAAGAGGTGAAGATCTCGAGATCTTCACCTCTTGTAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004131.4-562s21c1
Sequence:CCGGACAGTGCAGGAAGATCGAAAGCTCGAGCTTTCGATCTTCCTGCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004131.4-769s21c1
Sequence:CCGGAGCTTTGTACACTGGATAAAGCTCGAGCTTTATCCAGTGTACAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004131
GZMB MISSION shRNA shRNA Plasmid DNA
granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-711s1c1
Sequence:CCGGCATTGTCTCCTATGGACGAAACTCGAGTTTCGTCCATAGGAGACAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-601s1c1
Sequence:CCGGCATTATTACGACAGTACCATTCTCGAGAATGGTACTGTCGTAATAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-172s1c1
Sequence:CCGGGCTTATCTTATGATCTGGGATCTCGAGATCCCAGATCATAAGATAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-218s1c1
Sequence:CCGGGCTTCCTGATACAAGACGACTCTCGAGAGTCGTCTTGTATCAGGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-585s1c1
Sequence:CCGGCGAATCTGACTTACGCCATTACTCGAGTAATGGCGTAAGTCAGATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004131.4-540s21c1
Sequence:CCGGCACACTACAAGAGGTGAAGATCTCGAGATCTTCACCTCTTGTAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004131.4-562s21c1
Sequence:CCGGACAGTGCAGGAAGATCGAAAGCTCGAGCTTTCGATCTTCCTGCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004131.4-769s21c1
Sequence:CCGGAGCTTTGTACACTGGATAAAGCTCGAGCTTTATCCAGTGTACAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004131
GZMB MISSION shRNA Lentiviral Transduction Particles
granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-711s1c1
Sequence:CCGGCATTGTCTCCTATGGACGAAACTCGAGTTTCGTCCATAGGAGACAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-601s1c1
Sequence:CCGGCATTATTACGACAGTACCATTCTCGAGAATGGTACTGTCGTAATAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-172s1c1
Sequence:CCGGGCTTATCTTATGATCTGGGATCTCGAGATCCCAGATCATAAGATAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-218s1c1
Sequence:CCGGGCTTCCTGATACAAGACGACTCTCGAGAGTCGTCTTGTATCAGGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004131.3-585s1c1
Sequence:CCGGCGAATCTGACTTACGCCATTACTCGAGTAATGGCGTAAGTCAGATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004131.4-540s21c1
Sequence:CCGGCACACTACAAGAGGTGAAGATCTCGAGATCTTCACCTCTTGTAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004131.4-562s21c1
Sequence:CCGGACAGTGCAGGAAGATCGAAAGCTCGAGCTTTCGATCTTCCTGCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004131.4-769s21c1
Sequence:CCGGAGCTTTGTACACTGGATAAAGCTCGAGCTTTATCCAGTGTACAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013542
GZMB MISSION shRNA Bacterial Glycerol Stock
granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-812s1c1
Sequence:CCGGCGAGTTTCTTATCCTGGATAACTCGAGTTATCCAGGATAAGAAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013542.1-1139s1c1
Sequence:CCGGCGAGAATGTTATCTAATGCTACTCGAGTAGCATTAGATAACATTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-404s1c1
Sequence:CCGGCAGACTATAATCCTAAGACATCTCGAGATGTCTTAGGATTATAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-217s1c1
Sequence:CCGGGCCTTACTTTCGATCAAGGATCTCGAGATCCTTGATCGAAAGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-764s1c1
Sequence:CCGGCCTATGGATATAAGGATGGTTCTCGAGAACCATCCTTATATCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013542
GZMB MISSION shRNA shRNA Plasmid DNA
granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-812s1c1
Sequence:CCGGCGAGTTTCTTATCCTGGATAACTCGAGTTATCCAGGATAAGAAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013542.1-1139s1c1
Sequence:CCGGCGAGAATGTTATCTAATGCTACTCGAGTAGCATTAGATAACATTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-404s1c1
Sequence:CCGGCAGACTATAATCCTAAGACATCTCGAGATGTCTTAGGATTATAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-217s1c1
Sequence:CCGGGCCTTACTTTCGATCAAGGATCTCGAGATCCTTGATCGAAAGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-764s1c1
Sequence:CCGGCCTATGGATATAAGGATGGTTCTCGAGAACCATCCTTATATCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013542
GZMB MISSION shRNA Lentiviral Transduction Particles
granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-812s1c1
Sequence:CCGGCGAGTTTCTTATCCTGGATAACTCGAGTTATCCAGGATAAGAAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013542.1-1139s1c1
Sequence:CCGGCGAGAATGTTATCTAATGCTACTCGAGTAGCATTAGATAACATTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-404s1c1
Sequence:CCGGCAGACTATAATCCTAAGACATCTCGAGATGTCTTAGGATTATAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-217s1c1
Sequence:CCGGGCCTTACTTTCGATCAAGGATCTCGAGATCCTTGATCGAAAGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013542.1-764s1c1
Sequence:CCGGCCTATGGATATAAGGATGGTTCTCGAGAACCATCCTTATATCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)