EMAIL THIS PAGE TO A FRIEND

GZMH

granzyme H (cathepsin G-like 2, protein h-CCPX)

33 Gene Product Result for
Synonyms: CCP-X CGL-2 CSP-C CTLA1 CTSGL2
UniProtKB ID: P20718, G3V2C5, Q6XGZ0, Q6XGZ1
Gene ID:
Human(2999) Summary: The protein encoded by this gene is a member of the granzyme family. Members of this family are highly conserved serine proteases that eliminate transformed cells and virus-infected cells. This protein, which has chymotrypsin-like activity, has a preference for bulky aromatic amino acids at the P1 position and for acidic residues at the P3' and P4' positions. This protein is reported to be constitutively expressed in NK cells and may play a role in the cytotoxic arm of the innate immune response by inducing target cell death and by directly cleaving substrates in pathogen-infected cells. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
domestic guinea pig(100720497) granzyme H (cathepsin G-like 2, protein h-CCPX)
naked mole-rat(101702503) granzyme H (cathepsin G-like 2, protein h-CCPX)
cow(788601) granzyme H (cathepsin G-like 2, protein h-CCPX)
cow(617313) granzyme H (cathepsin G-like 2, protein h-CCPX)
dog(490629) granzyme H (cathepsin G-like 2, protein h-CCPX)
domestic cat(100113476) granzyme H (cathepsin G-like 2, protein h-CCPX)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033423 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104561 MISSION® esiRNA esiRNA human GZMH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033423 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038219 predicted 565
2 SASI_Hs01_00038220 predicted 545
3 SASI_Hs02_00361319 predicted 668
4 SASI_Hs01_00038222 predicted 556
5 SASI_Hs01_00038223 predicted 561
6 SASI_Hs01_00038224 predicted 555
7 SASI_Hs01_00038225 predicted 535
8 SASI_Hs01_00038226 predicted 519
9 SASI_Hs01_00038227 predicted 200
10 SASI_Hs01_00038228 predicted 559
11 SASI_Hs01_00038221 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033423
GZMH MISSION shRNA Bacterial Glycerol Stock
granzyme H (cathepsin G-like 2, protein h-CCPX)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033423.3-868s21c1
Sequence:CCGGGGTTGCAGGACTGTAATAAATCTCGAGATTTATTACAGTCCTGCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033423.3-767s21c1
Sequence:CCGGGAACAATGAAGCGCCTCTAACCTCGAGGTTAGAGGCGCTTCATTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033423.3-564s21c1
Sequence:CCGGACGTCTCTTCCATGGCAATTACTCGAGTAATTGCCATGGAAGAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033423.3-671s21c1
Sequence:CCGGAGGACGTAGCCCAAGGTATTCCTCGAGGAATACCTTGGGCTACGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033423.2-864s1c1
Sequence:CCGGTCAGGGTTGCAGGACTGTAATCTCGAGATTACAGTCCTGCAACCCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-765s1c1
Sequence:CCGGGAGAACAATGAAGCGCCTCTACTCGAGTAGAGGCGCTTCATTGTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-198s1c1
Sequence:CCGGCATCCTAGTGAGAAAGGACTTCTCGAGAAGTCCTTTCTCACTAGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-488s1c1
Sequence:CCGGGTTATGTCTCAATGAGCACTTCTCGAGAAGTGCTCATTGAGACATAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-684s1c1
Sequence:CCGGAGGTATTCTCTCCTATGGAAACTCGAGTTTCCATAGGAGAGAATACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033423
GZMH MISSION shRNA shRNA Plasmid DNA
granzyme H (cathepsin G-like 2, protein h-CCPX)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033423.3-868s21c1
Sequence:CCGGGGTTGCAGGACTGTAATAAATCTCGAGATTTATTACAGTCCTGCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033423.3-767s21c1
Sequence:CCGGGAACAATGAAGCGCCTCTAACCTCGAGGTTAGAGGCGCTTCATTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033423.3-564s21c1
Sequence:CCGGACGTCTCTTCCATGGCAATTACTCGAGTAATTGCCATGGAAGAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033423.3-671s21c1
Sequence:CCGGAGGACGTAGCCCAAGGTATTCCTCGAGGAATACCTTGGGCTACGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033423.2-864s1c1
Sequence:CCGGTCAGGGTTGCAGGACTGTAATCTCGAGATTACAGTCCTGCAACCCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-765s1c1
Sequence:CCGGGAGAACAATGAAGCGCCTCTACTCGAGTAGAGGCGCTTCATTGTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-198s1c1
Sequence:CCGGCATCCTAGTGAGAAAGGACTTCTCGAGAAGTCCTTTCTCACTAGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-488s1c1
Sequence:CCGGGTTATGTCTCAATGAGCACTTCTCGAGAAGTGCTCATTGAGACATAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-684s1c1
Sequence:CCGGAGGTATTCTCTCCTATGGAAACTCGAGTTTCCATAGGAGAGAATACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033423
GZMH MISSION shRNA Lentiviral Transduction Particles
granzyme H (cathepsin G-like 2, protein h-CCPX)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033423.3-868s21c1
Sequence:CCGGGGTTGCAGGACTGTAATAAATCTCGAGATTTATTACAGTCCTGCAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033423.3-767s21c1
Sequence:CCGGGAACAATGAAGCGCCTCTAACCTCGAGGTTAGAGGCGCTTCATTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033423.3-564s21c1
Sequence:CCGGACGTCTCTTCCATGGCAATTACTCGAGTAATTGCCATGGAAGAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033423.3-671s21c1
Sequence:CCGGAGGACGTAGCCCAAGGTATTCCTCGAGGAATACCTTGGGCTACGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006817    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033423.2-864s1c1
Sequence:CCGGTCAGGGTTGCAGGACTGTAATCTCGAGATTACAGTCCTGCAACCCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-765s1c1
Sequence:CCGGGAGAACAATGAAGCGCCTCTACTCGAGTAGAGGCGCTTCATTGTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-198s1c1
Sequence:CCGGCATCCTAGTGAGAAAGGACTTCTCGAGAAGTCCTTTCTCACTAGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-488s1c1
Sequence:CCGGGTTATGTCTCAATGAGCACTTCTCGAGAAGTGCTCATTGAGACATAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033423.2-684s1c1
Sequence:CCGGAGGTATTCTCTCCTATGGAAACTCGAGTTTCCATAGGAGAGAATACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)