EMAIL THIS PAGE TO A FRIEND

GZMK

granzyme K (granzyme 3; tryptase II)

76 Gene Product Result for
Synonyms: TRYP2
UniProtKB ID: P49863, B2R563
Gene ID:
Human(3003) Summary: This gene product is a member of a group of related serine proteases from the cytoplasmic granules of cytotoxic lymphocytes. Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein described here lacks consensus sequences for N-glycosylation present in other granzymes. [provided by RefSeq, Jul 2008]
Mouse(14945) granzyme K
Rat(29165) granzyme K
Zebrafish(794999) granzyme K
cow(528871) granzyme K (granzyme 3; tryptase II)
domestic cat(101088984) granzyme K (granzyme 3; tryptase II)
dog(489200) granzyme K (granzyme 3; tryptase II)
chicken(426168) granzyme K (granzyme 3; tryptase II)
domestic guinea pig(100727863) granzyme K (granzyme 3; tryptase II)
naked mole-rat(101707104) granzyme K (granzyme 3; tryptase II)
sheep(101117363) granzyme K (granzyme 3; tryptase II)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002104 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050771 MISSION® esiRNA esiRNA human GZMK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002104 Rosetta Predictions human pricing
NM_017119 Rosetta Predictions rat pricing
NM_008196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333216 predicted 722
2 SASI_Hs01_00129856 predicted 631
3 SASI_Hs01_00129857 predicted 816
4 SASI_Hs01_00129858 predicted 552
5 SASI_Hs01_00129859 predicted 354
6 SASI_Hs01_00129860 predicted 657
7 SASI_Hs01_00129861 predicted 725
8 SASI_Hs01_00129862 predicted 525
9 SASI_Hs02_00333217 predicted 700
10 SASI_Hs01_00129863 predicted 821
11 SASI_Hs01_00129864 predicted 368
12 SASI_Hs01_00129865 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032450 predicted 304
2 SASI_Rn01_00032451 predicted 560
3 SASI_Rn01_00032452 predicted 396
4 SASI_Rn01_00032453 predicted 319
5 SASI_Rn01_00032454 predicted 514
6 SASI_Rn02_00261358 predicted 473
7 SASI_Rn01_00032455 predicted 557
8 SASI_Rn01_00032456 predicted 631
9 SASI_Rn01_00032457 predicted 637
10 SASI_Rn01_00032458 predicted 426
11 SASI_Rn01_00032459 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106053 predicted 473
2 SASI_Mm01_00106054 predicted 491
3 SASI_Mm01_00106055 predicted 266
4 SASI_Mm01_00106056 predicted 528
5 SASI_Mm01_00106057 predicted 562
6 SASI_Mm01_00106058 predicted 461
7 SASI_Mm01_00106059 predicted 222
8 SASI_Mm01_00106060 predicted 467
9 SASI_Mm01_00106061 predicted 335
10 SASI_Mm02_00313340 predicted 511
11 SASI_Mm01_00106052 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002104
GZMK MISSION shRNA Bacterial Glycerol Stock
granzyme K (granzyme 3; tryptase II)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-316s1c1
Sequence:CCGGCTCCAAACAAACACTGGAGATCTCGAGATCTCCAGTGTTTGTTTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-507s1c1
Sequence:CCGGCCACCGATCCAGATTCATTAACTCGAGTTAATGAATCTGGATCGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-237s1c1
Sequence:CCGGCCCACTGCCAATATCGGTTTACTCGAGTAAACCGATATTGGCAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-758s1c1
Sequence:CCGGCCTGGAATCTACACCCTGTTACTCGAGTAACAGGGTGTAGATTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002104.1-887s1c1
Sequence:CCGGGCAGGTTAGAGTTGGGTGTAACTCGAGTTACACCCAACTCTAACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002104.2-146s21c1
Sequence:CCGGACCTCATTCCAGGCCATTTATCTCGAGATAAATGGCCTGGAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002104.2-819s21c1
Sequence:CCGGGTCCCGCCTCATACAAATTAACTCGAGTTAATTTGTATGAGGCGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002104.2-512s21c1
Sequence:CCGGCACCGATCCAGATTCATTAAGCTCGAGCTTAATGAATCTGGATCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002104
GZMK MISSION shRNA shRNA Plasmid DNA
granzyme K (granzyme 3; tryptase II)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-316s1c1
Sequence:CCGGCTCCAAACAAACACTGGAGATCTCGAGATCTCCAGTGTTTGTTTGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-507s1c1
Sequence:CCGGCCACCGATCCAGATTCATTAACTCGAGTTAATGAATCTGGATCGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-237s1c1
Sequence:CCGGCCCACTGCCAATATCGGTTTACTCGAGTAAACCGATATTGGCAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-758s1c1
Sequence:CCGGCCTGGAATCTACACCCTGTTACTCGAGTAACAGGGTGTAGATTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002104.1-887s1c1
Sequence:CCGGGCAGGTTAGAGTTGGGTGTAACTCGAGTTACACCCAACTCTAACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002104.2-146s21c1
Sequence:CCGGACCTCATTCCAGGCCATTTATCTCGAGATAAATGGCCTGGAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002104.2-819s21c1
Sequence:CCGGGTCCCGCCTCATACAAATTAACTCGAGTTAATTTGTATGAGGCGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002104.2-512s21c1
Sequence:CCGGCACCGATCCAGATTCATTAAGCTCGAGCTTAATGAATCTGGATCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002104
GZMK MISSION shRNA Lentiviral Transduction Particles
granzyme K (granzyme 3; tryptase II)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-316s1c1
Sequence:CCGGCTCCAAACAAACACTGGAGATCTCGAGATCTCCAGTGTTTGTTTGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-507s1c1
Sequence:CCGGCCACCGATCCAGATTCATTAACTCGAGTTAATGAATCTGGATCGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-237s1c1
Sequence:CCGGCCCACTGCCAATATCGGTTTACTCGAGTAAACCGATATTGGCAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002104.1-758s1c1
Sequence:CCGGCCTGGAATCTACACCCTGTTACTCGAGTAACAGGGTGTAGATTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002104.1-887s1c1
Sequence:CCGGGCAGGTTAGAGTTGGGTGTAACTCGAGTTACACCCAACTCTAACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002104.2-146s21c1
Sequence:CCGGACCTCATTCCAGGCCATTTATCTCGAGATAAATGGCCTGGAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002104.2-819s21c1
Sequence:CCGGGTCCCGCCTCATACAAATTAACTCGAGTTAATTTGTATGAGGCGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002104.2-512s21c1
Sequence:CCGGCACCGATCCAGATTCATTAAGCTCGAGCTTAATGAATCTGGATCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008196
GZMK MISSION shRNA Bacterial Glycerol Stock
granzyme K (granzyme 3; tryptase II)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008196.1-650s21c1
Sequence:CCGGTGATCTGCAAAGGCATCTTCCCTCGAGGGAAGATGCCTTTGCAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-546s1c1
Sequence:CCGGCCAAAGCTACTACAACCACAACTCGAGTTGTGGTTGTAGTAGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-99s1c1
Sequence:CCGGGCCGCATTCCAGGCCATTTATCTCGAGATAAATGGCCTGGAATGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-376s1c1
Sequence:CCGGGAACTAAACAAGAATGTCCAACTCGAGTTGGACATTCTTGTTTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-497s1c1
Sequence:CCGGCCCTGAGAGAAGTCACTGTTACTCGAGTAACAGTGACTTCTCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-271s1c1
Sequence:CCGGCCCATGAAGCAGACATTTGAACTCGAGTTCAAATGTCTGCTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008196.1-59s21c1
Sequence:CCGCAGTGTTTCCATACTGAAATTACTCGAGTAATTTCAGTATGGAAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008196.1-677s21c1
Sequence:CCGGTAGTCTCTCAGGGCTATAAATCTCGAGATTTATAGCCCTGAGAGACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008196
GZMK MISSION shRNA shRNA Plasmid DNA
granzyme K (granzyme 3; tryptase II)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008196.1-650s21c1
Sequence:CCGGTGATCTGCAAAGGCATCTTCCCTCGAGGGAAGATGCCTTTGCAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-546s1c1
Sequence:CCGGCCAAAGCTACTACAACCACAACTCGAGTTGTGGTTGTAGTAGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-99s1c1
Sequence:CCGGGCCGCATTCCAGGCCATTTATCTCGAGATAAATGGCCTGGAATGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-376s1c1
Sequence:CCGGGAACTAAACAAGAATGTCCAACTCGAGTTGGACATTCTTGTTTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-497s1c1
Sequence:CCGGCCCTGAGAGAAGTCACTGTTACTCGAGTAACAGTGACTTCTCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-271s1c1
Sequence:CCGGCCCATGAAGCAGACATTTGAACTCGAGTTCAAATGTCTGCTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008196.1-59s21c1
Sequence:CCGCAGTGTTTCCATACTGAAATTACTCGAGTAATTTCAGTATGGAAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008196.1-677s21c1
Sequence:CCGGTAGTCTCTCAGGGCTATAAATCTCGAGATTTATAGCCCTGAGAGACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008196
GZMK MISSION shRNA Lentiviral Transduction Particles
granzyme K (granzyme 3; tryptase II)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008196.1-650s21c1
Sequence:CCGGTGATCTGCAAAGGCATCTTCCCTCGAGGGAAGATGCCTTTGCAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-546s1c1
Sequence:CCGGCCAAAGCTACTACAACCACAACTCGAGTTGTGGTTGTAGTAGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-99s1c1
Sequence:CCGGGCCGCATTCCAGGCCATTTATCTCGAGATAAATGGCCTGGAATGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-376s1c1
Sequence:CCGGGAACTAAACAAGAATGTCCAACTCGAGTTGGACATTCTTGTTTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-497s1c1
Sequence:CCGGCCCTGAGAGAAGTCACTGTTACTCGAGTAACAGTGACTTCTCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008196.1-271s1c1
Sequence:CCGGCCCATGAAGCAGACATTTGAACTCGAGTTCAAATGTCTGCTTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008196.1-59s21c1
Sequence:CCGCAGTGTTTCCATACTGAAATTACTCGAGTAATTTCAGTATGGAAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008196.1-677s21c1
Sequence:CCGGTAGTCTCTCAGGGCTATAAATCTCGAGATTTATAGCCCTGAGAGACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)