EMAIL THIS PAGE TO A FRIEND

GZMM

granzyme M (lymphocyte met-ase 1)

45 Gene Product Result for
Synonyms: LMET1 MET1
UniProtKB ID: P51124
Gene ID:
Human(3004) Summary: Human natural killer (NK) cells and activated lymphocytes express and store a distinct subset of neutral serine proteases together with proteoglycans and other immune effector molecules in large cytoplasmic granules. These serine proteases are collectively termed granzymes and include 4 distinct gene products: granzyme A, granzyme B, granzyme H, and the protein encoded by this gene, granzyme M. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(16904) granzyme M (lymphocyte met-ase 1)
Rat(29252) granzyme M (lymphocyte met-ase 1)
sheep(101108227) granzyme M (lymphocyte met-ase 1)
chicken(100859124) granzyme M (lymphocyte met-ase 1)
cow(512272) granzyme M (lymphocyte met-ase 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005317 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044151 MISSION® esiRNA esiRNA human GZMM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005317 Rosetta Predictions human pricing
NM_057183 Rosetta Predictions rat pricing
NM_008504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188081 predicted 351
2 SASI_Hs01_00188082 predicted 718
3 SASI_Hs01_00188083 predicted 694
4 SASI_Hs01_00188085 predicted 303
5 SASI_Hs01_00188086 predicted 696
6 SASI_Hs01_00188087 predicted 252
7 SASI_Hs01_00188088 predicted 330
8 SASI_Hs01_00188089 predicted 325
9 SASI_Hs01_00188090 predicted 299
10 SASI_Hs02_00339387 predicted 555
11 SASI_Hs01_00188084 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267124 predicted 347
2 SASI_Rn02_00267125 predicted 414
3 SASI_Rn02_00267126 predicted 329
4 SASI_Rn02_00267127 predicted 603
5 SASI_Rn02_00267128 predicted 313
6 SASI_Rn02_00267129 predicted 351
7 SASI_Rn02_00267130 predicted 465
8 SASI_Rn02_00267131 predicted 468
9 SASI_Rn02_00267132 predicted 370
10 SASI_Rn02_00267133 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072780 predicted 696
2 SASI_Mm01_00072781 predicted 816
3 SASI_Mm02_00314058 predicted 763
4 SASI_Mm01_00072782 predicted 549
5 SASI_Mm01_00072783 predicted 961
6 SASI_Mm01_00072784 predicted 494
7 SASI_Mm01_00072785 predicted 445
8 SASI_Mm01_00072786 predicted 934
9 SASI_Mm01_00072787 predicted 631
10 SASI_Mm01_00072789 predicted 900
11 SASI_Mm01_00072788 predicted 691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005317
GZMM MISSION shRNA Bacterial Glycerol Stock
granzyme M (lymphocyte met-ase 1)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-570s21c1
Sequence:CCGGGTGTAACAACAGCCGCTTCTGCTCGAGCAGAAGCGGCTGTTGTTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-106s21c1
Sequence:CCGGTCCTTTGGGACCCAGATCATCCTCGAGGATGATCTGGGTCCCAAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-727s21c1
Sequence:CCGGAGGGTCTGCACTGACATCTTCCTCGAGGAAGATGTCAGTGCAGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-307s21c1
Sequence:CCGGGGTCTCACCTTCCACATCAAGCTCGAGCTTGATGTGGAAGGTGAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-776s21c1
Sequence:CCGGCTTACGTGTCCTGGATCAGGACTCGAGTCCTGATCCAGGACACGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-567s1c1
Sequence:CCGGCATGTGTAACAACAGCCGCTTCTCGAGAAGCGGCTGTTGTTACACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-306s1c1
Sequence:CCGGCGGTCTCACCTTCCACATCAACTCGAGTTGATGTGGAAGGTGAGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-723s1c1
Sequence:CCGGCTCCAGGGTCTGCACTGACATCTCGAGATGTCAGTGCAGACCCTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-315s1c1
Sequence:CCGGCTTCCACATCAAGGCAGCCATCTCGAGATGGCTGCCTTGATGTGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-90s1c1
Sequence:CCGGCCTGTCAGTAGGCAGCTCCTTCTCGAGAAGGAGCTGCCTACTGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005317
GZMM MISSION shRNA shRNA Plasmid DNA
granzyme M (lymphocyte met-ase 1)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-570s21c1
Sequence:CCGGGTGTAACAACAGCCGCTTCTGCTCGAGCAGAAGCGGCTGTTGTTACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-106s21c1
Sequence:CCGGTCCTTTGGGACCCAGATCATCCTCGAGGATGATCTGGGTCCCAAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-727s21c1
Sequence:CCGGAGGGTCTGCACTGACATCTTCCTCGAGGAAGATGTCAGTGCAGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-307s21c1
Sequence:CCGGGGTCTCACCTTCCACATCAAGCTCGAGCTTGATGTGGAAGGTGAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-776s21c1
Sequence:CCGGCTTACGTGTCCTGGATCAGGACTCGAGTCCTGATCCAGGACACGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-567s1c1
Sequence:CCGGCATGTGTAACAACAGCCGCTTCTCGAGAAGCGGCTGTTGTTACACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-306s1c1
Sequence:CCGGCGGTCTCACCTTCCACATCAACTCGAGTTGATGTGGAAGGTGAGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-723s1c1
Sequence:CCGGCTCCAGGGTCTGCACTGACATCTCGAGATGTCAGTGCAGACCCTGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-315s1c1
Sequence:CCGGCTTCCACATCAAGGCAGCCATCTCGAGATGGCTGCCTTGATGTGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-90s1c1
Sequence:CCGGCCTGTCAGTAGGCAGCTCCTTCTCGAGAAGGAGCTGCCTACTGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005317
GZMM MISSION shRNA Lentiviral Transduction Particles
granzyme M (lymphocyte met-ase 1)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-570s21c1
Sequence:CCGGGTGTAACAACAGCCGCTTCTGCTCGAGCAGAAGCGGCTGTTGTTACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-106s21c1
Sequence:CCGGTCCTTTGGGACCCAGATCATCCTCGAGGATGATCTGGGTCCCAAAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-727s21c1
Sequence:CCGGAGGGTCTGCACTGACATCTTCCTCGAGGAAGATGTCAGTGCAGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-307s21c1
Sequence:CCGGGGTCTCACCTTCCACATCAAGCTCGAGCTTGATGTGGAAGGTGAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005317.2-776s21c1
Sequence:CCGGCTTACGTGTCCTGGATCAGGACTCGAGTCCTGATCCAGGACACGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-567s1c1
Sequence:CCGGCATGTGTAACAACAGCCGCTTCTCGAGAAGCGGCTGTTGTTACACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-306s1c1
Sequence:CCGGCGGTCTCACCTTCCACATCAACTCGAGTTGATGTGGAAGGTGAGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-723s1c1
Sequence:CCGGCTCCAGGGTCTGCACTGACATCTCGAGATGTCAGTGCAGACCCTGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-315s1c1
Sequence:CCGGCTTCCACATCAAGGCAGCCATCTCGAGATGGCTGCCTTGATGTGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005317.2-90s1c1
Sequence:CCGGCCTGTCAGTAGGCAGCTCCTTCTCGAGAAGGAGCTGCCTACTGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008504
GZMM MISSION shRNA Bacterial Glycerol Stock
granzyme M (lymphocyte met-ase 1)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-701s1c1
Sequence:CCGGCCTGGCTACAACCACAAATATCTCGAGATATTTGTGGTTGTAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-910s1c1
Sequence:CCGGGCTGGATACCCAAATGTGTAACTCGAGTTACACATTTGGGTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-764s1c1
Sequence:CCGGCCCAGCAAGAATGTCAAACCACTCGAGTGGTTTGACATTCTTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-450s1c1
Sequence:CCGGGCAACAGATTTGAGACCCAGACTCGAGTCTGGGTCTCAAATCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-503s1c1
Sequence:CCGGCGCCCATACATGGCCTCTCTACTCGAGTAGAGAGGCCATGTATGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008504
GZMM MISSION shRNA shRNA Plasmid DNA
granzyme M (lymphocyte met-ase 1)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-701s1c1
Sequence:CCGGCCTGGCTACAACCACAAATATCTCGAGATATTTGTGGTTGTAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-910s1c1
Sequence:CCGGGCTGGATACCCAAATGTGTAACTCGAGTTACACATTTGGGTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-764s1c1
Sequence:CCGGCCCAGCAAGAATGTCAAACCACTCGAGTGGTTTGACATTCTTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-450s1c1
Sequence:CCGGGCAACAGATTTGAGACCCAGACTCGAGTCTGGGTCTCAAATCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-503s1c1
Sequence:CCGGCGCCCATACATGGCCTCTCTACTCGAGTAGAGAGGCCATGTATGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008504
GZMM MISSION shRNA Lentiviral Transduction Particles
granzyme M (lymphocyte met-ase 1)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-701s1c1
Sequence:CCGGCCTGGCTACAACCACAAATATCTCGAGATATTTGTGGTTGTAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-910s1c1
Sequence:CCGGGCTGGATACCCAAATGTGTAACTCGAGTTACACATTTGGGTATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-764s1c1
Sequence:CCGGCCCAGCAAGAATGTCAAACCACTCGAGTGGTTTGACATTCTTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-450s1c1
Sequence:CCGGGCAACAGATTTGAGACCCAGACTCGAGTCTGGGTCTCAAATCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008504.2-503s1c1
Sequence:CCGGCGCCCATACATGGCCTCTCTACTCGAGTAGAGAGGCCATGTATGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)