EMAIL THIS PAGE TO A FRIEND

H1F0

H1 histone family, member 0

70 Gene Product Result for
Synonyms: H10 H1FV
UniProtKB ID: P07305, B2R6I0, B4DRD6, Q6FG88, Q8N6R3
Gene ID:
Human(3005) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a member of the histone H1 family. [provided by RefSeq, Jul 2008]
Mouse(14958) H1 histone family, member 0
Rat(24437) H1 histone family, member 0
Zebrafish(321618) H1 histone family, member 0
cow(617975) H1 histone family, member 0
dog(610251) H1 histone family, member 0
chicken(693250) H1 histone family, member 0
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005318 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135871 MISSION® esiRNA esiRNA human H1F0 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005318 Rosetta Predictions human pricing
NM_012578 Rosetta Predictions rat pricing
NM_008197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339388 predicted 967
2 SASI_Hs01_00074653 predicted 723
3 SASI_Hs01_00074654 predicted 917
4 SASI_Hs01_00074655 predicted 620
5 SASI_Hs01_00074656 predicted 628
6 SASI_Hs01_00074657 predicted 909
7 SASI_Hs01_00074659 predicted 571
8 SASI_Hs01_00074660 predicted 532
9 SASI_Hs01_00074661 predicted 617
10 SASI_Hs01_00074662 predicted 1009
11 SASI_Hs01_00074658 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043117 predicted 707
2 SASI_Rn01_00043118 predicted 440
3 SASI_Rn01_00043119 predicted 435
4 SASI_Rn01_00043120 predicted 616
5 SASI_Rn01_00043121 predicted 335
6 SASI_Rn01_00043123 predicted 236
7 SASI_Rn01_00043125 predicted 671
8 SASI_Rn01_00043126 predicted 313
9 SASI_Rn02_00259711 predicted 374
10 SASI_Rn02_00259712 predicted 612
11 SASI_Rn01_00043122 predicted 310
12 SASI_Rn01_00043124 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056615 predicted 1222
2 SASI_Mm01_00056616 predicted 879
3 SASI_Mm01_00056617 predicted 1170
4 SASI_Mm01_00056618 predicted 1148
5 SASI_Mm01_00056619 predicted 1217
6 SASI_Mm01_00056621 predicted 589
7 SASI_Mm01_00056622 predicted 1379
8 SASI_Mm01_00056624 predicted 1176
9 SASI_Mm02_00313341 predicted 1384
10 SASI_Mm02_00313342 predicted 686
11 SASI_Mm01_00056620 predicted 610
12 SASI_Mm01_00056623 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005318
VALIDATED
H1F0 MISSION shRNA Bacterial Glycerol Stock
H1 histone family, member 0
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005318.3-1814s21c1
Sequence:CCGGGCCCTGTTGAAACTTAGGTTTCTCGAGAAACCTAAGTTTCAACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005318.3-633s21c1
Sequence:CCGGCTCGCAGATCAAGTTGTCCATCTCGAGATGGACAACTTGATCTGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005318.3-964s21c1
Sequence:CCGGGCCAAACCAGTGAAACCCAAACTCGAGTTTGGGTTTCACTGGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005318.3-750s21c1
Sequence:CCGGAGTGGCCTTCAAGAAGACCAACTCGAGTTGGTCTTCTTGAAGGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005318.2-892s1c1
Sequence:CCGGGCCAAACCAGTGAAACCCAAACTCGAGTTTGGGTTTCACTGGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005318.2-564s1c1
Sequence:CCGGGCAGATCAAGTTGTCCATCAACTCGAGTTGATGGACAACTTGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005318.2-678s1c1
Sequence:CCGGAGTGGCCTTCAAGAAGACCAACTCGAGTTGGTCTTCTTGAAGGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005318
VALIDATED
H1F0 MISSION shRNA shRNA Plasmid DNA
H1 histone family, member 0
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005318.3-1814s21c1
Sequence:CCGGGCCCTGTTGAAACTTAGGTTTCTCGAGAAACCTAAGTTTCAACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005318.3-633s21c1
Sequence:CCGGCTCGCAGATCAAGTTGTCCATCTCGAGATGGACAACTTGATCTGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005318.3-964s21c1
Sequence:CCGGGCCAAACCAGTGAAACCCAAACTCGAGTTTGGGTTTCACTGGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005318.3-750s21c1
Sequence:CCGGAGTGGCCTTCAAGAAGACCAACTCGAGTTGGTCTTCTTGAAGGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005318.2-892s1c1
Sequence:CCGGGCCAAACCAGTGAAACCCAAACTCGAGTTTGGGTTTCACTGGTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005318.2-564s1c1
Sequence:CCGGGCAGATCAAGTTGTCCATCAACTCGAGTTGATGGACAACTTGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005318.2-678s1c1
Sequence:CCGGAGTGGCCTTCAAGAAGACCAACTCGAGTTGGTCTTCTTGAAGGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005318
VALIDATED
H1F0 MISSION shRNA Lentiviral Transduction Particles
H1 histone family, member 0
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005318.3-1814s21c1
Sequence:CCGGGCCCTGTTGAAACTTAGGTTTCTCGAGAAACCTAAGTTTCAACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005318.3-633s21c1
Sequence:CCGGCTCGCAGATCAAGTTGTCCATCTCGAGATGGACAACTTGATCTGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005318.3-964s21c1
Sequence:CCGGGCCAAACCAGTGAAACCCAAACTCGAGTTTGGGTTTCACTGGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005318.3-750s21c1
Sequence:CCGGAGTGGCCTTCAAGAAGACCAACTCGAGTTGGTCTTCTTGAAGGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005318.2-892s1c1
Sequence:CCGGGCCAAACCAGTGAAACCCAAACTCGAGTTTGGGTTTCACTGGTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005318.2-564s1c1
Sequence:CCGGGCAGATCAAGTTGTCCATCAACTCGAGTTGATGGACAACTTGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005318.2-678s1c1
Sequence:CCGGAGTGGCCTTCAAGAAGACCAACTCGAGTTGGTCTTCTTGAAGGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008197
VALIDATED
H1F0 MISSION shRNA Bacterial Glycerol Stock
H1 histone family, member 0
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-666s21c1
Sequence:CCGGGTATATCAAGAGCCACTACAACTCGAGTTGTAGTGGCTCTTGATATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-744s21c1
Sequence:CCGGCGGTGTTCTCAAGCAAACCAACTCGAGTTGGTTTGCTTGAGAACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-708s21c1
Sequence:CCGGCCAGATCAAGTTGTCCATCAACTCGAGTTGATGGACAACTTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-988s21c1
Sequence:CCGGCCCAAGGTTGTCAAAGTCAAACTCGAGTTTGACTTTGACAACCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-493s1c1
Sequence:CCGGCGGTGTTCTCAAGCAAACCAACTCGAGTTGGTTTGCTTGAGAACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008197.3-1177s21c1
Sequence:CCGGGCCCATTCTATTCTGACTTTACTCGAGTAAAGTCAGAATAGAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-457s1c1
Sequence:CCGGCCAGATCAAGTTGTCCATCAACTCGAGTTGATGGACAACTTGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-415s1c1
Sequence:CCGGGTATATCAAGAGCCACTACAACTCGAGTTGTAGTGGCTCTTGATATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-737s1c1
Sequence:CCGGCCCAAGGTTGTCAAAGTCAAACTCGAGTTTGACTTTGACAACCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-926s1c1
Sequence:CCGGGCCCATTCTATTCTGACTTTACTCGAGTAAAGTCAGAATAGAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008197
VALIDATED
H1F0 MISSION shRNA shRNA Plasmid DNA
H1 histone family, member 0
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-666s21c1
Sequence:CCGGGTATATCAAGAGCCACTACAACTCGAGTTGTAGTGGCTCTTGATATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-744s21c1
Sequence:CCGGCGGTGTTCTCAAGCAAACCAACTCGAGTTGGTTTGCTTGAGAACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-708s21c1
Sequence:CCGGCCAGATCAAGTTGTCCATCAACTCGAGTTGATGGACAACTTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-988s21c1
Sequence:CCGGCCCAAGGTTGTCAAAGTCAAACTCGAGTTTGACTTTGACAACCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-493s1c1
Sequence:CCGGCGGTGTTCTCAAGCAAACCAACTCGAGTTGGTTTGCTTGAGAACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008197.3-1177s21c1
Sequence:CCGGGCCCATTCTATTCTGACTTTACTCGAGTAAAGTCAGAATAGAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-457s1c1
Sequence:CCGGCCAGATCAAGTTGTCCATCAACTCGAGTTGATGGACAACTTGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-415s1c1
Sequence:CCGGGTATATCAAGAGCCACTACAACTCGAGTTGTAGTGGCTCTTGATATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-737s1c1
Sequence:CCGGCCCAAGGTTGTCAAAGTCAAACTCGAGTTTGACTTTGACAACCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-926s1c1
Sequence:CCGGGCCCATTCTATTCTGACTTTACTCGAGTAAAGTCAGAATAGAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008197
VALIDATED
H1F0 MISSION shRNA Lentiviral Transduction Particles
H1 histone family, member 0
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-666s21c1
Sequence:CCGGGTATATCAAGAGCCACTACAACTCGAGTTGTAGTGGCTCTTGATATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-744s21c1
Sequence:CCGGCGGTGTTCTCAAGCAAACCAACTCGAGTTGGTTTGCTTGAGAACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-708s21c1
Sequence:CCGGCCAGATCAAGTTGTCCATCAACTCGAGTTGATGGACAACTTGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008197.3-988s21c1
Sequence:CCGGCCCAAGGTTGTCAAAGTCAAACTCGAGTTTGACTTTGACAACCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-493s1c1
Sequence:CCGGCGGTGTTCTCAAGCAAACCAACTCGAGTTGGTTTGCTTGAGAACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008197.3-1177s21c1
Sequence:CCGGGCCCATTCTATTCTGACTTTACTCGAGTAAAGTCAGAATAGAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-457s1c1
Sequence:CCGGCCAGATCAAGTTGTCCATCAACTCGAGTTGATGGACAACTTGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-415s1c1
Sequence:CCGGGTATATCAAGAGCCACTACAACTCGAGTTGTAGTGGCTCTTGATATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-737s1c1
Sequence:CCGGCCCAAGGTTGTCAAAGTCAAACTCGAGTTTGACTTTGACAACCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008197.2-926s1c1
Sequence:CCGGGCCCATTCTATTCTGACTTTACTCGAGTAAAGTCAGAATAGAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)